apeiros changed the topic of #ruby to: Ruby 2.1.0-p0; 2.0.0-p353; 1.9.3-p484: http://ruby-lang.org|| Paste >3 lines of text on http://gist.github.com || this channel is logged at http://irclog.whitequark.org, other public logging is prohibited
vlad_starkov has joined #ruby
vlad_starkov has quit [Remote host closed the connection]
lioninawhat has joined #ruby
lioninawhat has quit [Remote host closed the connection]
vlad_starkov has joined #ruby
saarinen has quit [Client Quit]
<godd2> RubyPanther ain't got nothin but love, babe
lioninawhat_ has joined #ruby
IceDragon has quit [Ping timeout: 252 seconds]
zumba_addict has joined #ruby
IceDragon has joined #ruby
vlad_starkov has quit [Remote host closed the connection]
vlad_starkov has joined #ruby
<Morrolan> Wasn't there some talk about `def foo(@bar); end` syntax once, which would automagically set instance variables? Is that still in the pipeline, or was that just a dream of mine?
monkegjinni has joined #ruby
<CodeBunny> shevy: scary no. distracting
popl has joined #ruby
popl has joined #ruby
<shevy> hehe
nateberkopec has joined #ruby
<RubyPanther> nerium: I often resort to doing my data calculations inside a database, because date and range functions are a strong point of SQL and a weak point in Ruby (due to a preference to lean on and pass through the traditional crufty C libs)
<nerium> RubyPanther: Yeah, I was thinking about moving this logic into pg, but it's a bit to complex atm
thisirs has quit [Read error: Connection reset by peer]
zumba_addict has quit [Ping timeout: 252 seconds]
<soahccc> Morrolan: looks weird since something like this is possible: def foo(a = @bar)
<soahccc> but is doing something different
popl has quit [Client Quit]
vt102 is now known as vt102-afk
lkba has joined #ruby
davidk has joined #ruby
davidk is now known as Guest86174
rburton- has joined #ruby
nateberkopec has quit [Ping timeout: 272 seconds]
zumba_addict has joined #ruby
zigomir has quit [Remote host closed the connection]
zigomir has joined #ruby
olivier_bK has joined #ruby
zumba_addict has quit [Ping timeout: 252 seconds]
aryaching has quit [Read error: Connection reset by peer]
relix has joined #ruby
zigomir has quit [Ping timeout: 272 seconds]
RoryHughes has joined #ruby
RoryHughes has quit [Max SendQ exceeded]
VTLob has quit [Quit: VTLob]
mklappstuhl has quit [Remote host closed the connection]
MrZYX is now known as MrZYX|off
MrZYX|off is now known as MrZYX
mklappstuhl has joined #ruby
dkamioka has joined #ruby
ktosiek has quit [Read error: Operation timed out]
lioninawhat has joined #ruby
lioninawhat has quit [Remote host closed the connection]
CodeBunny has quit [Quit: CodeBunny got lost. Send help!]
mklappst_ has joined #ruby
yjmsf20 has joined #ruby
lethjakman has joined #ruby
dkamioka has quit [Ping timeout: 272 seconds]
lioninawhat_ has quit [Ping timeout: 252 seconds]
siwica1 has quit [Ping timeout: 252 seconds]
lethjakm1 has quit [Ping timeout: 252 seconds]
mklappstuhl has quit [Ping timeout: 272 seconds]
lioninawhat has joined #ruby
popl has joined #ruby
popl has quit [Changing host]
popl has joined #ruby
charliesome has joined #ruby
charliesome has quit [Client Quit]
phipes has joined #ruby
nerium has quit [Quit: nerium]
siwica has joined #ruby
Kricir has joined #ruby
sparrovv has joined #ruby
nerium has joined #ruby
freezey has quit [Remote host closed the connection]
estebistec has quit [Remote host closed the connection]
shime_ has quit [Ping timeout: 248 seconds]
Mikhail has quit [Quit: Leaving]
estebistec has joined #ruby
rylinaux has quit [Quit: Quit - ZNC]
afhammad has joined #ruby
rylinaux has joined #ruby
lioninawhat has quit [Remote host closed the connection]
mhenrixon|afk is now known as mhenrixon
Vivekananda has joined #ruby
relix has quit [Quit: My MacBook Pro has gone to sleep. ZZZzzz…]
estebistec has quit [Ping timeout: 272 seconds]
St_Marx has quit [Remote host closed the connection]
afhammad has quit []
lockweel has joined #ruby
Kricir has quit [Ping timeout: 265 seconds]
phipes has quit []
nerium has quit [Quit: nerium]
DanAndreasson has quit [Read error: Connection reset by peer]
Notte has quit [Remote host closed the connection]
predator117 has quit [Ping timeout: 246 seconds]
fedesilva has joined #ruby
Hobogrammer has joined #ruby
mklappst_ has quit [Remote host closed the connection]
relix has joined #ruby
nerium has joined #ruby
timonv has joined #ruby
Notte has joined #ruby
Notte has quit [Remote host closed the connection]
Hobogrammer_ has quit [Ping timeout: 252 seconds]
aspires has joined #ruby
predator117 has joined #ruby
St_Marx has joined #ruby
aryaching has joined #ruby
mhenrixon is now known as mhenrixon|afk
timonv has quit [Ping timeout: 272 seconds]
mhenrixon|afk has quit [Quit: My MacBook Pro has gone to sleep. ZZZzzz…]
lethjakman has quit [Ping timeout: 260 seconds]
MrZYX is now known as MrZYX|off
aryaching has quit [Ping timeout: 252 seconds]
aryaching has joined #ruby
Lewix_ has quit [Remote host closed the connection]
MrZYX|off is now known as MrZYX
relix has quit [Quit: My MacBook Pro has gone to sleep. ZZZzzz…]
francisfish has joined #ruby
nerium has quit [Quit: nerium]
drumusician has quit [Ping timeout: 252 seconds]
nerium has joined #ruby
Cephalostrum has quit [Quit: Aim higher. Try this: why am I here? Why do I exist, and what is my purpose in this universe? (Answers: 'Cause you are. 'Cause you do. 'Cause I got a shotgun, and you ain't got one.)]
nateberkopec has joined #ruby
jonahR has joined #ruby
francisfish has quit [Ping timeout: 272 seconds]
vlad_sta_ has joined #ruby
robustus has quit [Ping timeout: 245 seconds]
vlad_sta_ has quit [Remote host closed the connection]
vlad_starkov has quit [Read error: Operation timed out]
nateberkopec has quit [Ping timeout: 252 seconds]
fedesilva has quit [Remote host closed the connection]
Deele has quit [Ping timeout: 260 seconds]
mostlybadfly has quit []
mostlybadfly has joined #ruby
radic has quit [Ping timeout: 272 seconds]
robustus has joined #ruby
fedesilva has joined #ruby
fedesilva has quit [Remote host closed the connection]
zumba_addict has joined #ruby
senayar has quit []
nerium has quit [Quit: nerium]
zumba_addict has quit [Ping timeout: 264 seconds]
mansi has joined #ruby
MrZYX is now known as MrZYX|off
pu22l3r_ has joined #ruby
weeems has quit [Ping timeout: 260 seconds]
mansi_ has joined #ruby
mansi has quit [Read error: Connection reset by peer]
aryaching has quit []
zumba_addict has joined #ruby
destructure has quit [Ping timeout: 245 seconds]
destructure has joined #ruby
marr has quit [Ping timeout: 252 seconds]
CodeBunny has joined #ruby
weeems has joined #ruby
coderhs has joined #ruby
dkamioka has joined #ruby
tylersmith has joined #ruby
heftig has quit [Quit: Quitting]
zumba_addict has quit [Ping timeout: 272 seconds]
heftig has joined #ruby
drumusician has joined #ruby
Gngsk has joined #ruby
dkamioka has quit [Ping timeout: 252 seconds]
tylersmith has quit [Read error: Connection reset by peer]
Cephalostrum has joined #ruby
Cephalostrum has quit [Max SendQ exceeded]
tylersmith has joined #ruby
Cephalostrum has joined #ruby
Cephalostrum has quit [Max SendQ exceeded]
Cephalostrum has joined #ruby
diegoviola has joined #ruby
drumusician has quit [Ping timeout: 252 seconds]
Cephalostrum has quit [Client Quit]
Gngsk has quit []
w|t has joined #ruby
tt1187 has quit [Ping timeout: 252 seconds]
Kricir has joined #ruby
pu22l3r_ has quit [Remote host closed the connection]
pu22l3r_ has joined #ruby
venkat has joined #ruby
CptJeanLucPicard has joined #ruby
CptJeanLucPicard has quit [Changing host]
CptJeanLucPicard has joined #ruby
Cephalostrum has joined #ruby
Kricir has quit [Ping timeout: 260 seconds]
ArchBeOS-work has quit [Read error: Connection reset by peer]
robwilliamsuk has quit [Ping timeout: 260 seconds]
tylersmith has quit [Remote host closed the connection]
robwilliamsuk has joined #ruby
Azure_ has joined #ruby
zumba_addict has joined #ruby
Cephalostrum has quit [Remote host closed the connection]
tylersmi_ has joined #ruby
leo-the-manic has quit [Read error: Connection reset by peer]
Cephalostrum has joined #ruby
pu22l3r_ has quit [Ping timeout: 252 seconds]
leo-the-manic has joined #ruby
_maes_ has quit [Ping timeout: 260 seconds]
DefV has quit [Ping timeout: 260 seconds]
DefV has joined #ruby
Dude007 has quit [Remote host closed the connection]
Cephalostrum has quit [Remote host closed the connection]
Azure has quit [Ping timeout: 260 seconds]
Cephalostrum has joined #ruby
Cephalostrum has quit [Max SendQ exceeded]
tylersmi_ has quit [Ping timeout: 260 seconds]
mr_red has quit [Quit: Bye :)]
ringaroses has quit [Quit: Leaving]
Cephalostrum has joined #ruby
MatthewsFace has joined #ruby
mspah_ has joined #ruby
lockweel has quit [Ping timeout: 245 seconds]
CodeBunny has quit [Quit: CodeBunny needs a carrot. Be back later.]
nateberkopec has joined #ruby
Hanmac has joined #ruby
sparrovv has quit [Remote host closed the connection]
Hanmac1 has quit [Ping timeout: 272 seconds]
mr_red has joined #ruby
apeiros has quit [Remote host closed the connection]
apeiros has joined #ruby
dorei has joined #ruby
nateberkopec has quit [Ping timeout: 264 seconds]
<nycjv321> I am calculating BigMath.PI(10000) and its taking forever... Is this normal?
pierre1 has quit [Ping timeout: 252 seconds]
<centrx> nycjv321, I just tried it and it took about 1 second or less
<nycjv321> sorry 10_000*
<nycjv321> same thing right?
<centrx> Same thing
<shevy> ruby ignores all _ in there
<nycjv321> Hmmm yea its taking forever
<shevy> the parser just tricks you into believing that _ is fancy :)
Lewix has joined #ruby
<shevy> that BigMath.PI thing takes about 2 or 3 seconds here
<shevy> centrx must have a fast machine
<shevy> and nycjv321 must have an i386
<nycjv321> lmao
<nycjv321> shevy: nice burn there. I have an i3.
<shevy> 1_0_0_0 * 2 # => 2000
<shevy> when I read the _ first time in pickaxe
<shevy> I thought it was meant only for 100_000 or 1_000_000
<shevy> because then it would be easier to read right? but oh no, all _ are ignored, which destroyed my impression of visual beauty :(
<centrx> He hasn't been the same since
<shevy> hehe
<shevy> anyone is doing anything related to shells or user input on the one hand, and ruby on the other hand?
<shevy> I need ideas! brain storming! things that must be added, features IDEAS
<centrx> What's ruby
<shevy> :(
<shevy> centrx, I like to think of this applicable to all scripting language in general actually
<shevy> perhaps it is time to learn python
<shevy> but I would have to leave #ruby for while I am learning hmmm
<Nilium> ruby is a dog
<centrx> You mean like DOS Batch files?
<Nilium> it rolls over and stuff
<shevy> eh
<shevy> DOS is so awful
<shevy> today I did "dir" and just wondered
<shevy> I wanted to create a file on Win 7 with cmd.exe
<shevy> touch did not work :(
<nycjv321> BigMath.PI(5000) for me takes 10 seconds!?!??!
<centrx> C:\DOS
<shevy> actually that reminds me, I need to have ruby run on an USB stick
<centrx> nycjv321, What version of Ruby are you running? What platform are you on?
<shevy> does one of you guys know if louis lavena is using IRC?
<nycjv321> Would JRuby be doing this?
<nycjv321> centrx: JRuby, Fedora 64bit
echevemaster has quit [Quit: Leaving]
<shevy> ack
<shevy> javaruby
<shevy> 10 seconds penality is deserved
<shevy> you use java after all :D
<shevy> is that startup time?
<nycjv321> I guess?
<shevy> or can you like run this in the jvm
* nycjv321 switches to another ruby version :)
Guest86174 has quit [Remote host closed the connection]
<Xuisce> shevy: sup
<shevy> Xuisce hmm are you the nick changer
<Xuisce> shevy: haha :P
<centrx> nycjv321, That could be it, there is a big warm-up time for JRuby
<Xuisce> well no I've kept this
<Xuisce> and will
<Xuisce> :)
<shevy> that's what you say now
<shevy> but in 3 days it's like a new nick
<shevy> haha
<shevy> a big warm-um tipe
<shevy> Jruby: "Hey look guys, lemme just do some exercise to warm up."
<shevy> Jruby: "Soon I will be ready!"
<shevy> Jruby: "Damn, lemme just go to McDonald's quickly to get something to eat... then I am ready."
<nycjv321> that is sad. Trying to get Rubinius working through RVM.
<shevy> ON WINDOWS?
eka has joined #ruby
mspah__ has joined #ruby
<nycjv321> It looks like thats post JVM start up. I sleep for 5 seceonds and then try benchmarking the command via Benchmark
jonathanwallace has quit [Quit: ZNC - http://znc.in]
MatthewsFace has quit [Ping timeout: 252 seconds]
mspah_ has quit [Ping timeout: 248 seconds]
MatthewsFace has joined #ruby
<centrx> nycjv321, I am not sure PI to 10,000 digits
fedesilva has joined #ruby
<nycjv321> I can't get it to calculate 10,000 digits. I am trying only 5000... :(
cyberarm has joined #ruby
kewubenduben has joined #ruby
Jetchisel has left #ruby ["Unfortunately time is always against us -- *Morpheus*"]
echevemaster has joined #ruby
<centrx> nycjv321, What is the application you are writing that requires massive concurrency?
Kricir has joined #ruby
pukkapi has quit [Remote host closed the connection]
Hanmac1 has joined #ruby
<nycjv321> centrx: I'm just learning about it. Eventually I want to try concurrency for load testing.
monkegjinni has quit [Remote host closed the connection]
fedesilva has quit [Ping timeout: 252 seconds]
<nycjv321> how do you just install standard gems? I got Rubinius installed via RVM but some of the standard libs aren't there? e.g. Benchmark.
mercwithamouth has quit [Ping timeout: 252 seconds]
jonathanwallace has joined #ruby
dkamioka has joined #ruby
drim has quit [Quit: drim]
<nycjv321> and rdoc* rbx is throwing some crazy exceptions.
<centrx> Use MRI 2.1.0 :)
prc has quit [Ping timeout: 252 seconds]
Kricir has quit [Ping timeout: 272 seconds]
Hanmac has quit [Ping timeout: 272 seconds]
<shevy> nycjv321 perhaps RVM crippled your build
<shevy> benchmark is always available
<shevy> but rubinius kinda turned everything into gems as far as I know
dkamioka has quit [Ping timeout: 272 seconds]
eka has quit [Quit: Computer has gone to sleep.]
mburns has quit [Ping timeout: 260 seconds]
estebistec has joined #ruby
deens has joined #ruby
deens has quit [Remote host closed the connection]
mburns has joined #ruby
timonv has joined #ruby
rickruby has quit [Remote host closed the connection]
samuel02 has quit [Remote host closed the connection]
<nycjv321> I tried MRI and calculating pi to 10,000 digits on 1 to 30 threads takes roughly 6.5 seconds.
fijimunkii has joined #ruby
m00nlight has joined #ruby
<soahccc> nycjv321: MRI won't really schedule other threads if one is doing math I think.
samuel02 has joined #ruby
<nycjv321> alot better then jruby
<nycjv321> ;)
<soahccc> I've seen a big difference between MRI an jruby... MRI haven't schedule a Thread at all while jruby does
<nycjv321> soahccc: try calculating pi. JRuby bombs on my machine.
timonv has quit [Read error: Operation timed out]
<soahccc> nycjv321: I'm a noob in math, how would I do this? xD
<nycjv321> soahccc: p BigMath.PI(10_000)
Solnse has quit [Quit: Leaving.]
Solnse has joined #ruby
<soahccc> is that a gem
<soahccc> ?
Solnse has quit [Read error: Connection reset by peer]
<nycjv321> soahccc: require 'bigdecimal'
<nycjv321> require 'bigdecimal/math'
samuel02 has quit [Ping timeout: 264 seconds]
Solnse has joined #ruby
<soahccc> nycjv321: lol wtf
<nycjv321> sup?
dorei has quit []
<soahccc> MRI has finished like immediately and jruby is still doing something
<nycjv321> ;)
<shevy> Jruby: "Soon I will be ready!"
<soahccc> MRI: @real=0.732187 jRuby: @real=93.181000 just another reason to bash java
<shevy> Jruby: "Please be a bit more patient."
<nycjv321> lmao!
<shevy> Jruby: "Feed me more CPU powah!"
<shevy> java is big bloated and slow
<shevy> we have the numbers ^^^ to back this up
estebistec has quit [Remote host closed the connection]
estebistec has joined #ruby
<RubyPanther> nycjv321: try my pi_pie gem it gives you 1M digits of pi https://github.com/rubypanther/pi_pie
<RubyPanther> puts PiPie.π.round(10_000).to_s("F")
<nycjv321> calculating 10,000 on my machine takes 6.5 seconds :(
<shevy> your machine is fail
<RubyPanther> It also has the Feynman Point: r = BigDecimal.new("1.0"); puts "The area of a circle with a %.01fcm radius: %scm2" % [r,(PiPie.Feynman*(r**2)).to_s("F")]
<nycjv321> shevy: dude its an i3!. But I am on IRC, have Youtube open, Amarok open and am using RubyMine.
deens has joined #ruby
dodosan has quit [Remote host closed the connection]
nateberkopec has joined #ruby
Seich has joined #ruby
estebistec has quit [Ping timeout: 260 seconds]
coda23 has joined #ruby
<shevy> and you are still slow
<nycjv321> :'(
<nycjv321> RubyMine is also running a JVM.
<shevy> the more the better
<shevy> try to find out how many JVM you can run before your i3 breaks
mspah__ has quit [Ping timeout: 252 seconds]
<nycjv321> lol
MatthewsFace has quit [Ping timeout: 272 seconds]
<shevy> hmm there are only two falsey values in boolean context, right?
<shevy> nil and false
<shevy> whereas: x = Array.new; puts 'hi' if x # would always output 'hi'
Seich has quit [Client Quit]
coda23 has quit [Client Quit]
tylersmith has joined #ruby
nateberkopec has quit [Ping timeout: 272 seconds]
coda23 has joined #ruby
dorei has joined #ruby
<centrx> [] is true
coda23 has quit [Remote host closed the connection]
<shevy> yeah
<RubyPanther> BigMath 6.020000 0.050000 6.070000 ( 6.154096) PiPie 0.890000 0.340000 1.230000 ( 1.236949)
chihhsin has quit [Ping timeout: 276 seconds]
<soahccc> Hmm why doesn't ruby queue have #unshift? :(
<shevy> guys for commenting, what would you rather use: http://pastie.org/8646752
coda23 has joined #ruby
rickruby has joined #ruby
<shevy> the one with a newline or the one without the newline
coda23 has quit [Client Quit]
<centrx> The code should be self-documenting, so you don't need comments
francisfish has joined #ruby
dodosan has joined #ruby
<soahccc> I would say the last one but I like yard as there is less formatting going in the comments
<RubyPanther> shevy: they're equally awful
Seich_ has joined #ruby
tylersmith has quit [Ping timeout: 265 seconds]
rickruby has quit [Remote host closed the connection]
mlpinit has quit [Remote host closed the connection]
mspah__ has joined #ruby
Liothen has quit [Remote host closed the connection]
francisfish has quit [Ping timeout: 272 seconds]
MatthewsFace has joined #ruby
fijimunkii has quit [Ping timeout: 252 seconds]
<shevy> you guys have no sense for aesthetics!
fijimunkii has joined #ruby
Liothen has joined #ruby
samuel02 has joined #ruby
fgo has joined #ruby
alexfreidah has quit [Ping timeout: 260 seconds]
<soahccc> Hmm I have to wonder why there are so few exposed array methods in the Queue class :/
paradisaeidae has joined #ruby
charliesome has joined #ruby
<shevy> because noone else is using it
Barrin6 has joined #ruby
<paradisaeidae> I read somewhere that Ruby 2.1(ish) has a call which will modify it's process name.. pls link me with??
<centrx> soahccc, Why are you using Queue, what's the point?
larissa has joined #ruby
<soahccc> centrx: well I could also use queue = []; queue.extend(MonitorMixin)
<soahccc> but then I have to write more synchronize blocks
aantix has joined #ruby
Danielpk has joined #ruby
samuel02 has quit [Ping timeout: 252 seconds]
<shevy> paradisaeidae never heard that before, but I am not using 2.1 so who knows. it seems weird though, the PID is set by the underlying OS isn't it?
gja has joined #ruby
<soahccc> paradisaeidae: what do you mean by process name?
freezey has joined #ruby
freezey has quit [Remote host closed the connection]
<paradisaeidae> Found it...setproctitle(string) → string
<paradisaeidae> ruby-doc.org/core-2.1.0/Process.html
SCommette has joined #ruby
CuriousPerson has joined #ruby
<CuriousPerson> What is a string literal?
<paradisaeidae> Thanks!!
<CuriousPerson> Can someone please tell me what a string literal is?
<shevy> wat
<shevy> "Sets the process title that appears on the ps(1) command. Not necessarily effective on all platforms. No exception will be raised regardless of the result, nor will NotImplementedError be raised even if the platform does not support the feature."
<shevy> CuriousPerson no idea. what is a literal?
<shevy> this is a string "blaaaa"
<soahccc> Isn't this the new syntax to make frozen strings?
<soahccc> that is one literal
<CuriousPerson> I tried reading this wikipedia page but I do not understand one thing about it. http://en.wikipedia.org/wiki/String_literal
<soahccc> "One way to create a String is to use single or double quotes inside a Ruby program to create what is called a string literal"
<soahccc> idk if this is correct
<centrx> CuriousPerson, A literal is just a thing that is what it is
<soahccc> and I think what everybody is talking about is this "so cold"f
yasushi has joined #ruby
<shevy> CuriousPerson well it seems as if it means "don't change it after creation"
venkat has quit [Remote host closed the connection]
<shevy> which makes them BORING strings
w4pm has joined #ruby
<centrx> CuriousPerson, String.new("hello") is a string object too, but it is represented by the String syntax
<centrx> my_var = "hello"
Kricir has joined #ruby
Danielpk has left #ruby [#ruby]
<centrx> my_var is a string, but it is a variable
<centrx> "hello" is LITERALLY a string
mweshi has joined #ruby
yacks has joined #ruby
<centrx> Likewise, x = 1
gja has quit [Quit: This computer has gone to sleep]
paradisaeidae has left #ruby [#ruby]
<centrx> 1 is an integer literal
<soahccc> shevy: little blue boringers? xD
<CuriousPerson> my_var is a variable that holds the value string right?
<shevy> soahccc boringers sounds kinda cool
<shevy> like HARBINGERS OF DOOM
<centrx> it holds the value "hello", which is of type string
byprdct has quit [Quit: My MacBook Pro has gone to sleep. ZZZzzz…]
dkamioka has joined #ruby
<shevy> CuriousPerson in ruby we have objects
<soahccc> doesn't it hold the reference only?
<shevy> x = Array.new; y = Hash.new; z = String.new
<soahccc> shevy: That is from doctor who if you know it
<centrx> soahccc, Yeah good point
<shevy> soahccc who?
<CuriousPerson> This is my question. String.new("hello"), What is "hello" assigned to? Is it assigned to String meaning that String.new(
<soahccc> shevy: exactly
<CuriousPerson> String.new("hello") = String = "hello"?
<shevy> soahccc well I know doctor who only from bloopers :D
<centrx> CuriousPerson, Yes
<CuriousPerson> I am going to run that in irb, thank you verrry much.
<shevy> I don't watch the modern episodes, save for bloopers. I never saw a single episode from "big bang theory", I couldn't be bothered, but I know the bloopers by heart!
agent_white has joined #ruby
w4pm has quit [Ping timeout: 246 seconds]
<centrx> CuriousPerson, Actually, it's String.new("hello") == "hello"
<CuriousPerson> shevy, please explain what you mean is objects.
<centrx> CuriousPerson, and String.new("hello").class == "hello".class == String
<CuriousPerson> centrx, I figured that. I just ran it in irb. However, what is the purpose of doing it that way.
<shevy> CuriousPerson it's all an object! there is no "type"!
<centrx> CuriousPerson, As opposed to...?
<shevy> the best you can do is object.is_a? NameOfClass and a few #to_BLA conversions
<CuriousPerson> What can you do with that syntax String.new("hello") when it doesn't even store into anything. I hope this isn't dumb question, I'm just curious.
<shevy> what do you mean store
<shevy> what do you want it to store?
Kricir has quit [Ping timeout: 272 seconds]
<soahccc> shevy: well bloopers would ruin the magic of such good series imho :D
<shevy> you didn't assign it to a variable
<centrx> CuriousPerson, Nothing really, it is that String is a class, just like Array, Hash, MyFavoriteClass
<shevy> soahccc but I dont wanna watch them! :( I grew up in a time where movies were better :P
<CuriousPerson> What I am saying is look.
* shevy looks.
<centrx> CuriousPerson, If you created your own class, like User, you would do User.new("bob", "123 Fake St")
<CuriousPerson> I put in irb, in the terminal String.new("hello")
<CuriousPerson> I got "hello"
<shevy> irb evals it
<shevy> in a .rb file nothing would happen
<CuriousPerson> It's just temporarily, that's it right?
<shevy> irb is different to ruby bla.rb
<centrx> CuriousPerson, Yes, there is no reason for someone to do String.new("hello") as opposed to "hello"
<shevy> you aren't really doing anything with String.new("hello")
<CuriousPerson> So why does it exist, is it for testing or what?
mspah__ has quit [Quit: This computer has gone to sleep]
MatthewsFace has quit [Quit: This computer has gone to sleep]
<centrx> CuriousPerson, But there is a reason for someone to do User.new("bob")
lukec has quit [Quit: lukec]
<centrx> CuriousPerson, String is a class, classes can be instantiated with Class.new
fijimunkii has quit [Ping timeout: 252 seconds]
<shevy> CuriousPerson because you initialize a class that way in ruby, it is common syntax
dkamioka has quit [Ping timeout: 265 seconds]
<agent_white> CuriousPerson: For awesomeness! You can load up files inside irb, and play with your classes interactively.
<CuriousPerson> Isn't that for classes and stuff. Oh my I am bad with classes don't please.
<shevy> CuriousPerson, here is the official documentation for class String -> http://ruby-doc.org/core-2.1.0/String.html
<CuriousPerson> I don't understand Classes that much.
<CuriousPerson> Thank you shevy.
<shevy> CuriousPerson what is your suggestion if you want to remove class String. what name would you give that page then?
<CuriousPerson> Huh.
<shevy> See, Array is there ruby-doc.org/core-2.1.0/Array.html
<centrx> shevy, You are just confusing him with your fancy mumbo-jumbo jokes
<shevy> it's no joke!
<shevy> you can create an array via Array.new or via [] CuriousPerson
<soahccc> the latter is the literal
<shevy> you can create a string with String.new or ""
<shevy> and a hash with hash.new or {}
<shevy> oops
<shevy> capitalized Hash.new
<soahccc> The question is: String.new("a") have I created one or two string objects? =)
binaryhat has joined #ruby
<centrx> Hold on
<centrx> The question is: What is object-oriented programming
<shevy> soahccc one!
darthdeus has quit [Quit: Leaving...]
mlpinit has joined #ruby
<shevy> soahccc but what if you use multiple #{}
<centrx> soahccc, I would say two, except the compiler may optimize it away
<shevy> I have no real idea, it's too late to think :-)
<CuriousPerson> soahccc, one
mspah__ has joined #ruby
MatthewsFace has joined #ruby
<CuriousPerson> I am not sure what object-oriented programming. Is there a difference, what types of different programming exist out there?
<pontiki> CuriousPerson: OO, functional, and procedural
<agent_white> Curious: OOP, functional, procedural...
<CuriousPerson> Wow.
<CuriousPerson> Mind BLOWN!!
Xeago has joined #ruby
<pontiki> INB4 AGENT WHITE
<agent_white> I hope one day to know one in each realm. But my brain is not prepared.
<agent_white> D:
<shevy> damn
<CuriousPerson> How is a programming language created, is it through binary and complicated stuff?
<shevy> agent_white woke up
<shevy> CuriousPerson all is 0 and 1
* pontiki gives agent_white a peanut butter chocolate chip cookie, fresh made
<agent_white> CuriousPerson: By your people of your name, of course!
yasushi has quit [Remote host closed the connection]
Azure_ is now known as Azure
<shevy> CuriousPerson do you really wanna know it all or do you just wanna create useful things instead
<CuriousPerson> What is the purpose of functional and procedural programming? What purpose do they serve, does it have more power?
<pontiki> modern programming languages are written using other programming languages to get enough stuff going, then they go native
yasushi has joined #ruby
* agent_white does the cookie dance
<CuriousPerson> I think I want to know it all.
mojjojo has joined #ruby
<shevy> :(
<pontiki> LRNITALL
<pontiki> ALL THE LANGUAGES
yasushi has quit [Read error: Connection reset by peer]
<centrx> CuriousPerson, They are ways of translating ideas into machine code.
* pontiki offers a pbcc cookie to shevy as well
<CuriousPerson> pontiki, So what is Ruby based on with that statement you have made.
<pontiki> C
<centrx> CuriousPerson, Different sets of ideas can be translated more effectively with different kinds of programming
yasushi has joined #ruby
<pontiki> the first Lisp interpretter i worked on was written in CDC 6600 Assembler
mlpinit has quit [Ping timeout: 252 seconds]
<CuriousPerson> centrx, I am a liberalist. I need a real world example to help me out. Can you provide one for me please.
<pontiki> what does being a liberalist have to do with needing a real world example?
<centrx> He might mean liberal arts
rburton- has quit [Quit: Linkinus - http://linkinus.com]
<CuriousPerson> This is not relevant but like I know that HTML and Ruby have purposes cause HTML is used for webpages while Ruby is used to program and etc.
<CuriousPerson> That's what I mean.
<soahccc> okay i tested it... String.new("") creates 2 string objects
mweshi has quit [Quit: Laters]
<centrx> CuriousPerson, You could describe how to build the ark of the covenant in mathematics, or in sentences in different languages, or you could draw a picture
<centrx> or make a movie
Xiti` has joined #ruby
<centrx> starring Harrison Ford
yasushi has quit [Remote host closed the connection]
<centrx> There, that should be a broad enough description
yasushi has joined #ruby
<pontiki> naaahhh... steve carrol, c'mon
<popl> Carell
<centrx> How do you know a tree is a tree? How many branches can a tree have. Must a tree have leaves, what about needles, or in the winter? Is it not a tree!
<CuriousPerson> soahccc How is it 2 objects?
fijimunkii has joined #ruby
<soahccc> CuriousPerson: All .new calls return a new object, you can't tamper with this. But the literal you pass to the new method also creates one
<CuriousPerson> centrx, It's obvious that a tree is a tree due to it's composition makeup or it's chromosomes. Think on a larger scale.
<CuriousPerson> You're looking outside the box.
<shevy> except if it is a plastic tree
<centrx> Is a picture of a tree a tree?
<agent_white> Who buys plastic trees, you can't smell them!
<popl> What about the data structure?
<CuriousPerson> Does a plastic tree have a composition including cells and DNA?
<shevy> agent_white hey they buy LIVE TREES for xmas!
<soahccc> I think they smell the most
<CuriousPerson> I don't think so.
Xiti has quit [Ping timeout: 265 seconds]
<agent_white> shevy: And then we slaugher them and hang decorations on their corpses. D:
<agent_white> slaughter even.
<Xuisce> shevy: sup
<Xuisce> :P
<agent_white> MERRYXMAS
nateberkopec has joined #ruby
<CuriousPerson> A picture of a tree is a picture.
<CuriousPerson> See the difference.
<centrx> A picture of what?
phinfonet has quit [Quit: exitiing]
yasushi has quit [Ping timeout: 246 seconds]
* soahccc has another Dr. Who reference... "An image of an angel is an angel"
<centrx> class Tree; def @dna = "GATTACAGATTACAGATTACA"; end
yfeldblum has quit [Ping timeout: 252 seconds]
rickruby has joined #ruby
<centrx> woops
<centrx> class Tree; def dna = "GATTACAGATTACAGATTACA"; end
<centrx> damn
<centrx> that's it I am out
<shevy> haha
binaryhat has quit [Quit: Leaving]
<shevy> centrx your last action was to describe the pre-evolutionary step for a bonsai tree
<pontiki> don't blink!
<centrx> class OakTree; def dna parent + "TGTC"; end
<centrx> class OakTree < Tree
<soahccc> pontiki: at least one who understands me :D
<pontiki> soahccc: RUN!
cyberarm has quit [Quit: Bye]
centrx has quit [Quit: Total biological failure]
centrx has joined #ruby
<centrx> Picture.new(my_tree.image)
<Jason> stop making fun of me ;9
byprdct has joined #ruby
Xiti` is now known as Xiti
nateberkopec has quit [Ping timeout: 265 seconds]
<popl> Ceci n'est pas une pipe.
<CuriousPerson> I have a good question.
<pontiki> TREACHERY!!!
<CuriousPerson> How am I able to do this in Ruby. *Please watch*
<CuriousPerson> If I am in irb
<CuriousPerson> I want the code to run like this
<CuriousPerson> What is your name
<CuriousPerson> Your name is (Would have to put something in like gets.chomp)
<CuriousPerson> Your name is (name)
* nycjv321 makes fun of Jason
<CuriousPerson> I tried doing puts "Your name is" gets.chomp but that's invalid.
<CuriousPerson> Any suggestions?
* popl makes fun of JSON
<nycjv321> CuriousPerson: please don't span channel.
ckinni has quit [Quit: My MacBook Pro has gone to sleep. ZZZzzz…]
<pontiki> that's not really spamming, nycjv321
<CuriousPerson> spam*
<pontiki> one sec, CuriousPerson
<nycjv321> pontiki: really?
<CuriousPerson> Ok, thank you.
<nycjv321> I've been kicked out of a channel for less lines..
* nycjv321 goes back to lurking...
amclain has joined #ruby
<centrx> nycjv321, Usually that is by a bot if you were doing something legitimate
<nycjv321> no I had channel ops telling me and I backtalked them.
<popl> So there you go.
<centrx> oh well backtalk will get you kicked :)
<nycjv321> centrx: lmao
radic has joined #ruby
<popl> Then the reason for you being kicked was your indignation.
<centrx> You have to say, Yes, Sir, No, Sir, Thank you Sir, may I have another Sir
<nycjv321> story of my life.
<pontiki> https://eval.in/91612 <- like that, CuriousPerson
<nycjv321> centrx: I've learned that the "Yes Masta" attitude usually gets me places.
<CuriousPerson> Thank you sir.
<pontiki> (ENOTASIR)
<CuriousPerson> ponotiki, I know how to do that.
<pontiki> maybe i misunderstood, then?
venkat has joined #ruby
<CuriousPerson> ponotiki, This is what I meant. https://eval.in/91614
<CuriousPerson> ponotiki, it's fine. Thank you for helping me.
Seich_ has quit [Quit: Computer has gone to sleep.]
<pontiki> CuriousPerson: https://eval.in/91616
Seich_ has joined #ruby
<pontiki> puts terminates the line with a "\n", print does not
mojjojo has quit [Quit: mojjojo]
<CuriousPerson> pontiki, thank you. I ran this in my current directory and it works!!! Thanks.
byprdct has quit [Quit: My MacBook Pro has gone to sleep. ZZZzzz…]
<CuriousPerson> That's so cool, I am learning.
gja has joined #ruby
* nycjv321 uses p
<CuriousPerson> pontiki, I understand everything in that program except for the \n, I have never seen that in my life. What is that anyway?
<nycjv321> CuriousPerson: new line
<nycjv321> CuriousPerson: go look up escape characters. You will most likely deal with \n => new line and \t => tab more often than others. These are usually standard in all programming languages.
<CuriousPerson> I don't get it, you can start a new line on an existing line?
<nycjv321> yes.
<CuriousPerson> Oh cool, thanks.
<nycjv321> If you have Line A and on that line you say Line A << "\n" << "\n" then those lines are just appended to the output.
<CuriousPerson> Not a relevant question but you're from NY correct?
* nycjv321 is from Long Island (woot woot) but grew up in the south (oh yea)
<CuriousPerson> What state.
Xiti has quit [Read error: Connection reset by peer]
<CuriousPerson> in the south
<nycjv321> Grew up in Lousisiana and then moved to North Carolina
Xiti has joined #ruby
<CuriousPerson> Never been to the south, I heard it's racist down there. Don't even want to talk about it.
<nycjv321> CuriousPerson: it was actaully alot better were I lived in Lousisiana then here in NC. I'm Mixed. So its been interesting.
Xiti has quit [Read error: Connection reset by peer]
<CuriousPerson> Oh ok.
<CuriousPerson> Back to what I was saying. Why don't you put \n in front of Enter your name: like this -> "Enter your name:\n"
<nycjv321> CuriousPerson: its up to you.
<CuriousPerson> https://eval.in/91616
<nycjv321> Do you want user to enter name on next line or current line?
<CuriousPerson> Does it work the same way, check out the link
<nycjv321> your using print so you will never get input there.
<nycjv321> Sorry
<nycjv321> print should work*
<nycjv321> don't use puts!*
<nycjv321> Is print not working?
zumba_addict has quit [Ping timeout: 246 seconds]
chrisseaton has quit []
<CuriousPerson> I didn't even realized that, I didn't write the code btw.
dvdb has joined #ruby
<CuriousPerson> What is the difference between print and puts?
braincrash has quit [Quit: bye bye]
<CuriousPerson> in ruby programming
<n88> CuriousPerson: one appends a newline character and one doesn't
<nycjv321> CuriousPerson: print does not append new line and one does.
<nycjv321> As has been stated above.
<CuriousPerson> Append = ?
<n88> so if you did `puts "hello"`
<nycjv321> So what ever string you add e.g. "My Boss String" it will add a new line to it.
<nycjv321> Just try it dude.
<n88> you will see hello and any new data will be on the next line
<n88> if you put `print "hello"`
<n88> you will see "hello" and any data will be appended directly behind it on the same line
samuel02 has joined #ruby
<CuriousPerson> n88 I am understanding sort of I am at 65% now.
<nycjv321> CuriousPerson: just try it.
<n88> CuriousPerson: load up irb
<n88> and test for yourself
<nycjv321> CuriousPerson: add another new line even a tab :)
<CuriousPerson> So like. puts is going to put whatever is in quotes then go to the NEXT line
<CuriousPerson> However for prints
braincrash has joined #ruby
<CuriousPerson> Print will put whatever is next to it but the data will stay on the same line?
<CuriousPerson> ok
<CuriousPerson> I am in irb.
<CuriousPerson> I got this.
<CuriousPerson> Hello=>nil
<nycjv321> CuriousPerson: don't use IRB.
<n88> ignore the nil
<nycjv321> Just write the code and run it.
<n88> thats just the return value of the function
<CuriousPerson> I think nil means nothing and ok.
<DanBoy> you can think of puts like print with automatic newline on it
Xiti has joined #ruby
* nycjv321 finds IRB annoying.
<popl> Why?
* nycjv321 just cuz (new Nike phrase btw :) )
<popl> Brilliant justification.
<n88> nycjv321: have you used pry before ?
* nycjv321 bows
zumba_addict has joined #ruby
<CuriousPerson> Oh I saw it.
<nycjv321> n88: no but it looks awesome
nari has joined #ruby
<CuriousPerson> I put print then under the print statement I put a puts statement. It took the puts statement and put it on the same line print was on.
<DanBoy> gist it up man
Lulzon is now known as LulzonAway
<CuriousPerson> yeah IRB is annoying but is good for testing shit.
gja has quit [Quit: This computer has gone to sleep]
* nycjv321 tests in production
<DanBoy> just use a file
centrx has quit [Quit: Leaving]
centrx has joined #ruby
rickruby has quit [Remote host closed the connection]
Seich_ has quit [Quit: Computer has gone to sleep.]
samuel02 has quit [Ping timeout: 260 seconds]
<DanBoy> if you use a file its a lot easier to gist it up so people can see what your doing
<agent_white> CuriousPerson: Czech out pry. It's like IRB but cooler.
Xeago has quit [Remote host closed the connection]
centrx has quit [Client Quit]
centrx has joined #ruby
<CuriousPerson> Ooooh.
<agent_white> Woops, didn't see the above.
<agent_white> Is there an echo in here?
<CuriousPerson> \a does this beeping noise!!!!
<DanBoy> system bell
<CuriousPerson> That's so coo ool and I am learning!
<DanBoy> you know how to make a .rb file though?
<DanBoy> something you can put code in and run
<CuriousPerson> I am going to flood my text editor with that escape character. Oh yes.
<CuriousPerson> I know how to make a rb file.
<DanBoy> you can't be in irb testing everything im just saying
<CuriousPerson> IRB and me <3
<DanBoy> not when you need to code something thats like 50 lines long
<CuriousPerson> Yeah I know.
snapcase has quit [Quit: leaving]
<DanBoy> blah 20 lines long
Kricir has joined #ruby
<DanBoy> i use it as a calculator mostly
vt102-afk is now known as vt102
<nycjv321> DanBoy: you can use bc in linux
dkamioka has joined #ruby
timonv has joined #ruby
bjhaid has joined #ruby
<DanBoy> echo "20 * 20" | bc i've been doing for years
<DanBoy> i dunno i switch back and forth
yfeldblum has joined #ruby
<popl> bc <<< '20 * 20'
chipotle has joined #ruby
byprdct has joined #ruby
<CuriousPerson> Does anyone in here have the occupation of a computer programmer?
<DanBoy> actually i think there was a reason i stopped using bc
<DanBoy> i forgot though
<centrx> We prefer to be called "gurus"
<agent_white> Someday :(
<CuriousPerson> I am curious to know about the occupation and would like to speak to someone in here.
<popl> just ask
<popl> or ask on one of the stackexchange sites
snapcase has joined #ruby
<CuriousPerson> Do you get paid well for being a Computer Programmer?
<popl> That is subjective.
Kricir has quit [Ping timeout: 272 seconds]
<CuriousPerson> To be honest, I don't know how to use stackoverflow, it's so hard to understand?
<DanBoy> jsut gist your code and ask in here
<CuriousPerson> To me, never been on it before that much or made an account.
<popl> It can be difficult for someone who's never used it, I suppose.
<agent_white> I have yet to have good enough questions to need an account.
timonv has quit [Ping timeout: 272 seconds]
<CuriousPerson> popl, False but alright.
<popl> What?
dkamioka has quit [Ping timeout: 252 seconds]
dvdb has quit [Ping timeout: 272 seconds]
<CuriousPerson> There are these type of people called fast learners. I am not a fast learning but a slow learner.
<DanBoy> you just think you are
<popl> I'm not interested.
<CuriousPerson> I am not mentally incompetent or anything but I am just saying.
<popl> CuriousPerson: What you are is seeking attention. Please stop.
<CuriousPerson> No, I know I am.
<popl> CuriousPerson: If you have a ruby question, go ahead and ask it.
<DanBoy> just bang out some books on ruby and ask questions here you'll be fine
<CuriousPerson> Whatever you put here is going to cause attention, you make no sense.
popl has left #ruby [#ruby]
<DanBoy> lolz
yfeldblum has quit [Remote host closed the connection]
<CuriousPerson> Do Computer Programmers get paid well?
<DanBoy> its subjective dude
<DanBoy> it depends what the hell your doing i guess
yfeldblum has joined #ruby
<CuriousPerson> DanBoy you're*
RomAbptTHN has joined #ruby
RomAbptTHN has left #ruby [#ruby]
mlpinit has joined #ruby
venkat has quit [Read error: Connection reset by peer]
<DanBoy> alr8 dude
<DanBoy> trhanks for correcting me
venkat has joined #ruby
<DanBoy> have fun with fucking printf
<DanBoy> massive goal
<CuriousPerson> DanBoy thanks*
<DanBoy> hope you make it past %s
<chipotle> hi all
<DanBoy> you'll be awesome
<CuriousPerson> DanBoy Please mind your language in the chatlobby.
longlongji has joined #ruby
<centrx> lol
<centrx> This guy is a real character
<DanBoy> fucking dude comes in with questions on how puts() works and wants to be a dick
<DanBoy> last time i answer _you're_ responses
<CuriousPerson> DanBoy, I will have to report you for explicit and inappropriate language. Second Warning. Thank you.
baroquebobcat has joined #ruby
<pontiki> blah blah blah
<pontiki> sound and fury, signifying nothing
<centrx> Advanced troll, or simpleton, you decide!
<DanBoy> not that advanced
mlpinit has quit [Read error: Operation timed out]
<DanBoy> i was more advanced at 14
<centrx> The quality of trolling has gone down these days
<pontiki> dubios:
nateberkopec has joined #ruby
<CuriousPerson> What is the common programming languages used in the industry today?
<dorei> java
<centrx> binary
<n88> CuriousPerson: depends what industry
<dorei> java is the new cobol afterall xD
<DanBoy> hes trolling dude
mansi has joined #ruby
<CuriousPerson> n88, the computer industry. I want to be a programmer.
<CuriousPerson> In the programming industry I guess.
<n88> DanBoy: ah
<n88> lol
<n88> CuriousPerson: either D or brainfuck
mansi_ has quit [Ping timeout: 252 seconds]
<pontiki> dubios: sorry, errant kbd hit, didn't mean to highlight you
mehlah has quit [Quit: Leaving...]
<CuriousPerson> n88, huh?
<n88> CuriousPerson: either D or brainfuck
<CuriousPerson> What do you mean by that?
<pontiki> those are programming languages
dorei has quit []
Kricir has joined #ruby
<centrx> brainfuck is definitely the language for CuriousPerson
Barrin6 has quit [Quit: Leaving]
nateberkopec has quit [Ping timeout: 252 seconds]
byprdct has quit [Quit: My MacBook Pro has gone to sleep. ZZZzzz…]
araujo has joined #ruby
araujo has quit [Read error: Connection reset by peer]
<CuriousPerson> You guys are reported sorry. I had to report you guys for inappropriate language.
<n88> CuriousPerson: eat a dick
<DanBoy> a bowl of them
mansi has quit [Ping timeout: 260 seconds]
<n88> extra large bowl
<n88> with no milk
sassamo has quit [Remote host closed the connection]
coder60 has joined #ruby
<coder60> Hello.
<centrx> Ahoy
cj3kim has joined #ruby
sassamo has joined #ruby
longlongji has quit [Remote host closed the connection]
ckinni has joined #ruby
fgo has quit [Remote host closed the connection]
banjara has joined #ruby
Seich_ has joined #ruby
CuriousPerson has quit [Ping timeout: 272 seconds]
aspires has quit []
sassamo has quit [Ping timeout: 258 seconds]
decoponio has joined #ruby
Seich_ has quit [Ping timeout: 252 seconds]
dseitz has joined #ruby
Xiti has quit [Read error: Connection reset by peer]
Xiti has joined #ruby
ewnd9 has joined #ruby
Seich_ has joined #ruby
siwica has quit [Ping timeout: 252 seconds]
<nycjv321> Trying to load a module but the name is ambigious.
<nycjv321> How do I tell the intepreter to include a specific class?
<dseitz> Is it possible to use a fully-qualified name for it?
francisfish has joined #ruby
Zhwazi has quit [Ping timeout: 245 seconds]
mlpinit has joined #ruby
<coder60> :A String literal created with single quotes does not support interpolation." Is this true, this is on the bottom of this page, can someone explain this please? https://rubymonk.com/learning/books/1-ruby-primer/chapters/5-strings/lessons/31-string-basics
lioninawhat has joined #ruby
<centrx> coder60, Yes, it is true
<dseitz> single quote is a basic string
Seich_ is now known as Seich
francisfish has quit [Ping timeout: 272 seconds]
nari has quit [Ping timeout: 265 seconds]
<coder60> What is it saying about the escape character though?
<dseitz> '\n' prints '\n'
<dseitz> where as "\n" prints
<dseitz>
Zhwazi has joined #ruby
alexfreidah has joined #ruby
zumba_addict has quit [Ping timeout: 272 seconds]
<DanBoy> coder60, you fucking tard you can't even get a new proxy
Es0teric has joined #ruby
<DanBoy> hes trolling again
<centrx> haha
<coder60> I'm not trolling.... I'm serious.
danijoo has quit [Read error: Connection reset by peer]
<centrx> Don't give him any ideas
<DanBoy> ya ok /whowas curiousperson
<DanBoy> and match the fucking ip
<DanBoy> stupid fuck
<DanBoy> use tor at least
<DanBoy> god
<coder60> dseitz, tyq
danijoo has joined #ruby
<centrx> coder60, You should try reading up on these things first
<dseitz> They are the same, but maybe he has changed
<coder60> DanBoy, hop off.
<DanBoy> pretty easy to identify by you typing style as well retard
<centrx> Watch out, you don't want him to report you again!
<DanBoy> your use of extreme proper grammar gives you away
<coder60> That's right. <:
zumba_addict has joined #ruby
<coder60> Why thank you sir.
byprdct has joined #ruby
Xiti has quit [Read error: Connection reset by peer]
dan__ has joined #ruby
<dseitz> this rubymonk thing is pretty cool, btw
<dseitz> wish I had that when I was learning :)
Xiti has joined #ruby
alexfreidah has quit [Ping timeout: 260 seconds]
<DanBoy> honestly if you were 14 or so i would laugh
<dan__> HAHA
<DanBoy> looks like your a bit older which is sad
<DanBoy> nothing better to do then waste peoples time on IRC
<DanBoy> lol
<dan__> lol
<DanBoy> you're the joke
<DanBoy> not the people responding to you
dodosan has quit [Remote host closed the connection]
<dan__> i invented ruby
<dseitz> I have to go down the path of PHP wizardry soon, leaving the Zen of Ruby for a few this next contract :S
<DanBoy> dan__, im not talking to you
<dan__> i am the createor or ruby
<DanBoy> at all dude
dan__ is now known as sharkman
<DanBoy> im talking to coder60
<DanBoy> hes been trolling lol
<dseitz> /ignore is your friend
<coder60> Thanks dseitz.
<coder60> I will use that now.
<sharkman> does anyone want to know about ruby
<coder60> Ha ha, I ignored him. Stoopid monkey.
<dseitz> coder60, you should check out rubykoans, kind of an interesting run
<coder60> What is that? rubykoans?
<coder60> Is it a website or something?
ahmedelgabri has joined #ruby
<DanBoy> dseitz, hes trolling dude don't waste your time
<dseitz> TDD approach to learning, you download the project and fix it
samuel02 has joined #ruby
dodosan has joined #ruby
ahmedelgabri has quit [Remote host closed the connection]
<dseitz> Oh, guess I'm ignorant to these things. :)
<sharkman> cna you read me some rubykoans now
<coder60> dseitz, So it's something for people that want a challenge?
baroquebobcat has quit [Quit: baroquebobcat]
ahmedelgabri has joined #ruby
<DanBoy> hes going to slowly pretend hes new to coding asking bullshit questions on puts() and keep you going and 10 minutes from now tell you to fuck off
<coder60> Also, how come I didn't ignore this child. How do I ignore people.
<DanBoy> he already did it once under another alias
<DanBoy> its the same guy
<centrx> he spels gud tho
<DanBoy> that he does
SCommette has quit [Quit: SCommette]
<DanBoy> he talks good
<sharkman> sell me some ruby
sassamo has joined #ruby
deens has quit [Remote host closed the connection]
<coder60> How do you ignore people in this thing.
<DanBoy> /server help ignore
<dseitz> Interesting, Dan, meet, Dan, meet, Dan...
<dseitz> And I'm almost Dan :S
<dseitz> weirdos!
diegoviola has quit [Quit: WeeChat 0.4.2]
Seich has quit [Quit: Lingo - http://www.lingoirc.com]
deens has joined #ruby
seich- is now known as Seich
<sharkman> DEATH TO RUBY
<sharkman> LONG LIVE RUBY
samuel02 has quit [Ping timeout: 252 seconds]
<sharkman> cna you guys IP ban me if i get really crazy in here
<DanBoy> yes
<DanBoy> every tor exit node is banned
<sharkman> would you ip ban me
<DanBoy> for example
<sharkman> i dont tor so dont worry about that
<coder60> Why can't I do any freaking commands.
<DanBoy> /server help
<coder60> It keeps on saying I am not the operator but I want this guy to stop talking to me.
centrx has quit [Quit: Leaving]
<pontiki> coder60: try /ignore
<coder60> I did.
<sharkman> coder what is your name
<coder60> He can still see my chat.
centrx has joined #ruby
<coder60> John.
deens has quit [Ping timeout: 260 seconds]
<pontiki> oh, it doesn't work that way
<pontiki> there is no /shun command; only network i've seen that on was bigpond/telstra
rickruby has joined #ruby
<coder60> There is no command for it!!!! ;-; Sad.
<DanBoy> coder60, you're a fucking amateur at trolling dude when i was 14 i had #openbsd going for over an hour pretending i found an integer overflow in the pre auth code
<DanBoy> and your in your 20's with nothing better to do
<pontiki> DanBoy: you are annoying
<DanBoy> your the joke dude
sassamo has quit [Ping timeout: 252 seconds]
<coder60> He's obnoxious.
<DanBoy> thank you
<coder60> DanBoy you're*
dkamioka has joined #ruby
<coder60> Someone didn't do well in grammar school.
<pontiki> welcome to the internet http://www.fenixdev.net/
<dseitz> hehehe
<sharkman> danboy what is an integer overflow
<sharkman> is danboy the smartest person in the chat?
<sharkman> i cant even understand what he says
<DanBoy> lol ok im done with you two guys
<DanBoy> good luck tho with the trolling
<DanBoy> have fun
<dseitz> The problem is they are getting the result they desire from you.
<DanBoy> yup
<sharkman> danboy dont worry about them they are just being silly
<sharkman> danboy you aren't upset right? they are just being amateur jerks
<coder60> I think that DanBoy is slightly autistic, I don't blame him. He seems like the guy that comes from an abuse home. Let's show him some love. <3
coderhs has quit [Ping timeout: 272 seconds]
<dseitz> Just ignore the bunch, brother. So you can recapture the chat.
vim_shim_ has quit [Ping timeout: 252 seconds]
Seich is now known as seich
Seich_ has joined #ruby
brain_shim has quit [Ping timeout: 252 seconds]
Seich_ has quit [Client Quit]
BFF has quit [Remote host closed the connection]
<pontiki> see, coder60, now you've jumped into the space of obnoxious NT
<coder60> Ok pontiki.
lioninawhat has quit [Remote host closed the connection]
dkamioka has quit [Ping timeout: 260 seconds]
<pontiki> ask ruby questions. explain rubyisms. talk about programming. i'm just a geek in the channel. i have no power, no voice, but jeepers, come to learn, come to share.
<pontiki> this place is what you make of it.
freezey has joined #ruby
mary5030 has joined #ruby
<nycjv321> Can you override OpenStruct's to_s ?
<centrx> nycjv321, Yes
<coder60> pontiki, If you don't mind me asking, are you over the age of 25?
<nycjv321> centrx: through monkey coding? or as a field? e.g. some_open_struct.to_s ?
<centrx> nycjv321, Everything can be overridden
<pontiki> holy crap
nateberkopec has joined #ruby
<centrx> nycjv321, It is probably a bad idea to override it. Better would be a subclass
<pontiki> i'm over twice that age
Seich_ has joined #ruby
<nycjv321> centrx: what is proper way?
<pontiki> why, coder60 ?
<centrx> nycjv321, Make a class, like class MyOpenStruct < OpenStruct; def to_s; new code; end
<nycjv321> I'll just make my own class.
* nycjv321 sighs
<centrx> nycjv321, But with to_s it might be fun to just override it on top
<coder60> I am just curious to know.
lfox has joined #ruby
<centrx> nycjv321, In that case, you can just do class OpenStruct etc
<coder60> You don't have to answer me, I'm really not expecting an answer but if I get one that would be cool.
<pontiki> OpenStruct is kind of an interesting class. I haven't found much use for it, but it fascinates me.
<pontiki> I used it to build a mock I probably shouldn't have.
<pontiki> oh, i did answer you
larissa has quit [Quit: Leaving]
Kabaka has quit [Ping timeout: 264 seconds]
Rylee has quit [Ping timeout: 252 seconds]
<nycjv321> OpenStruct is facinating but limiting.
<nycjv321> whats really cool is its a C++ data structure.
<nycjv321> take that Java :)
nateberkopec has quit [Ping timeout: 260 seconds]
Rylee has joined #ruby
robert__ has quit [Read error: Connection reset by peer]
Kabaka has joined #ruby
ffio has quit [Quit: WeeChat 0.4.1]
Seich_ has quit [Quit: Lingo - http://www.lingoirc.com]
<dseitz> Love the enthusiasm; not sure how Java not being C++ is painful to Java :)
fixl has joined #ruby
deens has joined #ruby
diegoviola has joined #ruby
coderhs has joined #ruby
deens has quit [Read error: Connection reset by peer]
freezey has quit [Remote host closed the connection]
deens has joined #ruby
<pontiki> javabadger don't givadamn
_5kg has quit [Ping timeout: 260 seconds]
coder60 has quit [Ping timeout: 272 seconds]
cj3kim has quit [Remote host closed the connection]
deens has quit [Ping timeout: 252 seconds]
dfcnvt has quit [Ping timeout: 272 seconds]
dfcnvt has joined #ruby
thealch3m1st has joined #ruby
sepp2k has quit [Read error: Connection reset by peer]
sparrovv has joined #ruby
<sharkman> DOWN WITH RUBY
<pontiki> UP WITH SAPHIRE
sparrovv has quit [Read error: Connection reset by peer]
rukku has joined #ruby
agent_white has quit [Read error: Connection reset by peer]
coder_neo has joined #ruby
* nycjv321 grabs his battle spears
ewnd9 has quit [Ping timeout: 248 seconds]
BrixSat has quit [Remote host closed the connection]
BrixSat has joined #ruby
agent_white has joined #ruby
zIWYIiWPIS has joined #ruby
zIWYIiWPIS has left #ruby [#ruby]
aleandros has joined #ruby
aleandros has left #ruby [#ruby]
St_Marx has quit [Ping timeout: 264 seconds]
intuxicated has quit [Ping timeout: 264 seconds]
Jetchisel has joined #ruby
timonv has joined #ruby
browndawg has joined #ruby
sski has joined #ruby
samuel02 has joined #ruby
nisstyre has quit [Ping timeout: 260 seconds]
timonv has quit [Ping timeout: 272 seconds]
coder_neo has quit [Quit: This computer has gone to sleep]
Hanmac has joined #ruby
Hanmac1 has quit [Ping timeout: 260 seconds]
rukku has quit [Read error: Connection reset by peer]
samuel02 has quit [Ping timeout: 272 seconds]
heftig has quit [Ping timeout: 272 seconds]
heftig has joined #ruby
yaymukund has joined #ruby
Zespre has quit [Quit: leaving]
dkamioka has joined #ruby
nisstyre has joined #ruby
fijimunkii has quit [Ping timeout: 252 seconds]
chihhsin has joined #ruby
nateberkopec has joined #ruby
fijimunkii has joined #ruby
dkamioka has quit [Ping timeout: 272 seconds]
mlpinit has quit [Remote host closed the connection]
nateberkopec has quit [Ping timeout: 248 seconds]
Es0teric has quit [Quit: Computer has gone to sleep.]
chrisramon has joined #ruby
nari has joined #ruby
venkat has quit [Remote host closed the connection]
IceDragon has quit [Quit: Space~~~]
kep has joined #ruby
kep has left #ruby [#ruby]
tjbiddle has joined #ruby
glebm1 has joined #ruby
ciwolsey has quit [Remote host closed the connection]
<krainboltgreene> nycjv321 centrx As long as your OpenStruct usage is limited.
mansi has joined #ruby
<krainboltgreene> And yes, you can actually override any method on an OpenStruct class by making the field the method name.
<krainboltgreene> You get some buggy results.
<krainboltgreene> pontiki: I've found it a great tool for dealing with the stupid "is it a symbol or string for a key?" rubyism.
<krainboltgreene> All comes out a method in ostruct.
<nycjv321> krainboltgreene: I wasn't about to overload to_s. I just ended up making a class
<krainboltgreene> Kay.
<nycjv321> able*
<krainboltgreene> My astruct lets you do it without problems.
<krainboltgreene> Because astruct aliases to_s to __to_s__.
<krainboltgreene> I kinda wish there was a way to see if a method has been overloaded, and then if so call a specific version.
<krainboltgreene> I know Io does this.
fijimunkii has quit [Ping timeout: 252 seconds]
mansi has quit [Ping timeout: 272 seconds]
lfox has quit [Quit: ZZZzzz…]
fijimunkii has joined #ruby
ewnd9 has joined #ruby
St_Marx has joined #ruby
ahmedelgabri has quit [Remote host closed the connection]
Hanmac1 has joined #ruby
tjbiddle has quit [Quit: tjbiddle]
sassamo has joined #ruby
Hanmac has quit [Ping timeout: 272 seconds]
nisstyre has quit [Quit: Leaving]
sassamo has quit [Ping timeout: 248 seconds]
fijimunkii has quit [Read error: Connection reset by peer]
<nycjv321> FYI: Apparently from the #rubinius channel I have been informed that the standard Ruby libraries don't come installed.. They need to be installed via the gem manager.
venkat has joined #ruby
fijimunkii has joined #ruby
freezey has joined #ruby
Kricir has quit [Remote host closed the connection]
kobain has quit [Ping timeout: 252 seconds]
francisfish has joined #ruby
mlpinit has joined #ruby
nycjv321 has quit [Quit: leaving]
mary5030 has quit [Remote host closed the connection]
freezey has quit [Ping timeout: 246 seconds]
byprdct has quit [Ping timeout: 264 seconds]
francisfish has quit [Ping timeout: 252 seconds]
kobain has joined #ruby
mlpinit has quit [Ping timeout: 260 seconds]
<xybre> Yes, the stdlib is seperate and optional in Rubinius
<RubyPanther> Bizarre since they otherwise claim to value compatibility... in Ruby the stdlib is defined as part of the language
alexfreidah has joined #ruby
kobain has quit [Client Quit]
deens has joined #ruby
chihhsin has quit [Quit: leaving]
v10energy has quit [Ping timeout: 272 seconds]
alexfreidah has quit [Ping timeout: 252 seconds]
chrisramon has quit [Quit: chrisramon]
Hanmac has joined #ruby
<krainboltgreene> No it's not.
<krainboltgreene> RubyPanther: It's just as optional.
<krainboltgreene> The difference being the Rubinius source doesn't include a folder.
<krainboltgreene> Ruby code using standard libraries and Rubinius code using standard libraries are compatible.
chihhsin has joined #ruby
chihhsin has quit [Client Quit]
deens has quit [Ping timeout: 265 seconds]
Hanmac2 has joined #ruby
chihhsin has joined #ruby
chihhsin has quit [Client Quit]
thealch3m1st has quit [Quit: My MacBook Pro has gone to sleep. ZZZzzz…]
Hanmac1 has quit [Ping timeout: 252 seconds]
mityaz has joined #ruby
daidoji has joined #ruby
rickruby has quit [Remote host closed the connection]
Hanmac has quit [Ping timeout: 264 seconds]
diegoviola has quit [Ping timeout: 252 seconds]
thealch3m1st has joined #ruby
zumba_addict has quit [Ping timeout: 272 seconds]
bjhaid has quit [Ping timeout: 264 seconds]
samuel02 has joined #ruby
nateberkopec has joined #ruby
chihhsin has joined #ruby
amclain has quit [Quit: Leaving]
centrx has quit [Quit: Leaving]
dkamioka has joined #ruby
samuel02 has quit [Ping timeout: 252 seconds]
nateberkopec has quit [Ping timeout: 260 seconds]
jonahoffline has joined #ruby
Oog has joined #ruby
jonahoffline has quit [Client Quit]
<Oog> how does ruby compare to Go Lang for acting as an SMTP server/servicing many connections?
AlSquirrel has joined #ruby
<Oog> I have an SMTP server written based on GServer and I'm wondering if I need to convert to something based on Go like https://github.com/flashmob/go-guerrilla
ged_ has joined #ruby
charlies_ has joined #ruby
BrixSat_ has joined #ruby
jrd0 has quit [Ping timeout: 264 seconds]
AlSquire has quit [Ping timeout: 264 seconds]
zastern has quit [Ping timeout: 264 seconds]
ce_afk has quit [Ping timeout: 264 seconds]
fijimunkii has quit [Ping timeout: 264 seconds]
BrixSat has quit [Ping timeout: 264 seconds]
gigetoo has quit [Ping timeout: 264 seconds]
Brando753 has quit [Ping timeout: 264 seconds]
Mohan has quit [Ping timeout: 264 seconds]
epic has quit [Ping timeout: 264 seconds]
jmaister has quit [Ping timeout: 264 seconds]
ged has quit [Ping timeout: 264 seconds]
bpgoldsb has quit [Ping timeout: 264 seconds]
skyjumper has quit [Ping timeout: 264 seconds]
slash_nick has quit [Ping timeout: 264 seconds]
error404 has quit [Ping timeout: 264 seconds]
bpgoldsb|too has joined #ruby
DanKnox_ is now known as DanKnox
error404_ has joined #ruby
charliesome has quit [Ping timeout: 264 seconds]
jonahR has quit [Ping timeout: 264 seconds]
bsdbandit has quit [Ping timeout: 264 seconds]
spinx^ has quit [Ping timeout: 264 seconds]
bsdbandit has joined #ruby
DanKnox is now known as 77CAA0A23
cescalanl has joined #ruby
spinx^ has joined #ruby
jrd0 has joined #ruby
slash_nick has joined #ruby
ahmedelgabri has joined #ruby
fijimunkii has joined #ruby
gigetoo has joined #ruby
Brando753 has joined #ruby
jmaister has joined #ruby
epic has joined #ruby
dkamioka has quit [Ping timeout: 272 seconds]
zastern has joined #ruby
Mohan has joined #ruby
Mohan has quit [Changing host]
Mohan has joined #ruby
skyjumper has joined #ruby
skyjumper has quit [Changing host]
skyjumper has joined #ruby
Xuisce has quit [Quit: adios Amigos]
Olipro has quit [Ping timeout: 246 seconds]
Olipro has joined #ruby
bluOxigen has joined #ruby
yaymukund has quit [Ping timeout: 252 seconds]
mansi has joined #ruby
gja has joined #ruby
gja has quit [Changing host]
gja has joined #ruby
OdNairy has joined #ruby
glebm1 has quit [Ping timeout: 252 seconds]
lukec has joined #ruby
mansi has quit [Ping timeout: 252 seconds]
daidoji has quit []
OdNairy has quit [Quit: My MacBook Pro has gone to sleep. ZZZzzz…]
Fire-Dragon-DoL has quit [Quit: Leaving.]
sassamo has joined #ruby
lukec has quit [Quit: lukec]
banjara has quit [Quit: Leaving.]
fijimunkii has quit [Read error: Connection reset by peer]
rubyracer has joined #ruby
cbetta_afk is now known as cbetta
_5kg has joined #ruby
abra has joined #ruby
sassamo has quit [Ping timeout: 272 seconds]
rippa has joined #ruby
gja has quit [Quit: This computer has gone to sleep]
mlpinit has joined #ruby
timonv has joined #ruby
vlad_starkov has joined #ruby
cbetta is now known as cbetta_afk
mlpinit has quit [Ping timeout: 272 seconds]
Oog has quit []
starkhalo has quit [Ping timeout: 248 seconds]
timonv has quit [Ping timeout: 248 seconds]
vlad_starkov has quit [Ping timeout: 252 seconds]
coder_neo has joined #ruby
zxd has joined #ruby
jmaister has quit [Ping timeout: 248 seconds]
banjara has joined #ruby
ahmedelgabri has quit [Remote host closed the connection]
nateberkopec has joined #ruby
dangerousdave has joined #ruby
sski has quit [Remote host closed the connection]
sski has joined #ruby
yasushi has joined #ruby
sski has quit [Remote host closed the connection]
sski has joined #ruby
nateberkopec has quit [Ping timeout: 264 seconds]
zxq9 has joined #ruby
banjara has quit [Quit: Leaving.]
banjara has joined #ruby
samuel02 has joined #ruby
yacks has quit [Read error: Operation timed out]
dkamioka has joined #ruby
yacks has joined #ruby
coder_neo has quit [Quit: This computer has gone to sleep]
samuel02 has quit [Ping timeout: 252 seconds]
cbetta_afk is now known as cbetta
Hanmac has joined #ruby
skyjumper has quit [Remote host closed the connection]
skyjumper has joined #ruby
nm has joined #ruby
nm has quit [Client Quit]
dkamioka has quit [Ping timeout: 252 seconds]
Hanmac2 has quit [Ping timeout: 252 seconds]
cbetta is now known as cbetta_afk
nism has joined #ruby
<nism> Hello
mhenrixon has joined #ruby
monkegjinni has joined #ruby
OdNairy has joined #ruby
cjsarette has quit [Ping timeout: 248 seconds]
aantix has quit [Quit: aantix]
yasushi has quit [Remote host closed the connection]
vim_shim_ has joined #ruby
brain_shim has joined #ruby
<bricker`LA> hello
yasushi has joined #ruby
monkegjinni has quit [Ping timeout: 272 seconds]
<agent_white> Why do I segfault Ruby when I am learning in irb :(
<agent_white> "[NOTE]You may have encountered a bug in the Ruby interpreter or extension libraries.
<bricker`LA> agent_white: which version
<agent_white> bricker`LA: ruby 2.1.0p0 (2013-12-25 revision 44422) [x86_64-linux]
Deejay_ has joined #ruby
<agent_white> It happens when I run my specs, or try to start rails server...
<agent_white> But off-and-on.
samuel02 has joined #ruby
SHyx0rmZ has joined #ruby
<bricker`LA> agent_white: That was happening to me a while ago, turned out to be a horrible memory leak - some code was trying to load virtually every record in the database (hundreds of thousands) because of some autoloading association stuff.
<bricker`LA> agent_white: so maybe look for something like that
yasushi has quit [Ping timeout: 252 seconds]
<agent_white> bricker`LA: Sounds like I just need to update Ruby? I'm nowhere near advanced enough to read this output.
<bricker`LA> agent_white: if there is a newer patch out, you could upgrade to that
mhenrixon|afk has quit [Quit: My MacBook Pro has gone to sleep. ZZZzzz…]
<agent_white> bricker`LA: Yeah I think I will tomorrow. Think it's just about time for some shut-eye ;P
samuel02 has quit [Ping timeout: 272 seconds]
dodosan has quit [Remote host closed the connection]
sassamo has joined #ruby
dseitz has quit [Quit: Textual IRC Client: www.textualapp.com]
Deejay_ has quit [Quit: Computer has gone to sleep.]
banjara has quit [Quit: Leaving.]
sassamo has quit [Ping timeout: 272 seconds]
francisfish has joined #ruby
Hanmac1 has joined #ruby
abra has quit [Quit: Textual IRC Client: www.textualapp.com]
mlpinit has joined #ruby
relix has joined #ruby
Hanmac has quit [Ping timeout: 272 seconds]
vlad_starkov has joined #ruby
francisfish has quit [Ping timeout: 252 seconds]
claymore has joined #ruby
TaxmanBD has joined #ruby
vlad_starkov has quit [Read error: Connection reset by peer]
agent_white has quit [Quit: gnight]
mlpinit has quit [Ping timeout: 248 seconds]
alexfreidah has joined #ruby
cjsarette has joined #ruby
nateberkopec has joined #ruby
jgrevich has joined #ruby
intuxicated has joined #ruby
gja has joined #ruby
alexfreidah has quit [Ping timeout: 252 seconds]
gja has quit [Client Quit]
claymore has quit [Ping timeout: 252 seconds]
nateberkopec has quit [Ping timeout: 272 seconds]
iMe has quit [Quit: Bye Bye]
gja has joined #ruby
iMe has joined #ruby
bluOxigen has quit [Ping timeout: 248 seconds]
claymore has joined #ruby
shime has joined #ruby
gja has quit [Client Quit]
rukku has joined #ruby
assurbanipal has joined #ruby
gja has joined #ruby
pskosinski has joined #ruby
cbetta_afk is now known as cbetta
w4pm has joined #ruby
dkamioka has joined #ruby
coder_neo has joined #ruby
venkat has quit []
cbetta is now known as cbetta_afk
w4pm has quit [Ping timeout: 260 seconds]
dkamioka has quit [Ping timeout: 264 seconds]
utkarsh has left #ruby ["Textual IRC Client: www.textualapp.com"]
phansch has joined #ruby
visof has joined #ruby
tt1187 has joined #ruby
gja has quit [Quit: This computer has gone to sleep]
cbetta_afk is now known as cbetta
coderhs has quit [Ping timeout: 265 seconds]
Deejay_ has joined #ruby
cbetta is now known as cbetta_afk
Samsung-User_ has joined #ruby
mansi has joined #ruby
cbetta_afk is now known as cbetta
Samsung-User__ has joined #ruby
rukku has quit [Ping timeout: 246 seconds]
darthdeus has joined #ruby
mansi has quit [Ping timeout: 260 seconds]
Samsung-User_ has quit [Ping timeout: 260 seconds]
samuel02 has joined #ruby
Samsung-User__ has quit [Ping timeout: 246 seconds]
dangerousdave has quit [Quit: My Mac Pro has gone to sleep. ZZZzzz…]
okinomo has joined #ruby
wallerdev has quit [Quit: wallerdev]
monkegjinni has joined #ruby
timonv has joined #ruby
samuel02 has quit [Ping timeout: 260 seconds]
JasmeetQA has joined #ruby
ndrei has joined #ruby
sassamo has joined #ruby
JasmeetQA has quit [Quit: Leaving.]
timonv has quit [Ping timeout: 246 seconds]
mhenrixon has joined #ruby
JasmeetQA1 has joined #ruby
yaymukund has joined #ruby
mocfive has quit [Remote host closed the connection]
JasmeetQA1 has quit [Read error: Connection reset by peer]
sassamo has quit [Ping timeout: 260 seconds]
Deejay_ has quit [Quit: Textual IRC Client: www.textualapp.com]
banjara has joined #ruby
sparrovv has joined #ruby
synergy__ has quit [Read error: Connection reset by peer]
carraroj has joined #ruby
cbetta is now known as cbetta_afk
apeiros has quit [Read error: Connection reset by peer]
mlpinit has joined #ruby
nateberkopec has joined #ruby
apeiros has joined #ruby
visof has quit [Quit: Reconnecting]
visof has joined #ruby
visof has quit [Changing host]
visof has joined #ruby
banjara has quit [Ping timeout: 252 seconds]
sparrovv has quit [Ping timeout: 260 seconds]
cbetta_afk is now known as cbetta
mhenrixon is now known as mhenrixon|afk
coder_neo has quit [Ping timeout: 260 seconds]
mlpinit has quit [Ping timeout: 264 seconds]
mhenrixon|afk has quit [Quit: My MacBook Pro has gone to sleep. ZZZzzz…]
nateberkopec has quit [Ping timeout: 252 seconds]
coder_neo has joined #ruby
Akuma has quit [Ping timeout: 272 seconds]
cbetta is now known as cbetta_afk
cbetta_afk is now known as cbetta
alexherbo2 has joined #ruby
monkegjinni has quit [Remote host closed the connection]
monkegjinni has joined #ruby
cbetta is now known as cbetta_afk
marr has joined #ruby
drumusician has joined #ruby
Soda has quit [Remote host closed the connection]
mspah__ has quit [Quit: This computer has gone to sleep]
MatthewsFace has quit [Quit: This computer has gone to sleep]
mhenrixon has joined #ruby
monkegjinni has quit [Ping timeout: 252 seconds]
banjara has joined #ruby
fgo has joined #ruby
Akuma has joined #ruby
dkamioka has joined #ruby
timonv has joined #ruby
Speed has joined #ruby
banjara has quit [Ping timeout: 272 seconds]
shime has quit [Ping timeout: 272 seconds]
dkamioka has quit [Ping timeout: 248 seconds]
rippa has quit [Quit: {#`%${%&`+'${`%&NO CARRIER]
colonolGron has joined #ruby
nism has quit [Ping timeout: 252 seconds]
max96at has joined #ruby
sski has quit [Remote host closed the connection]
araujo has joined #ruby
sski has joined #ruby
spider-mario has joined #ruby
monkegjinni has joined #ruby
sski has quit [Ping timeout: 265 seconds]
mansi has joined #ruby
ahmedelgabri has joined #ruby
frog0909 has quit [Ping timeout: 272 seconds]
monkegjinni has quit [Ping timeout: 272 seconds]
sparrovv has joined #ruby
frog0909 has joined #ruby
mansi has quit [Ping timeout: 265 seconds]
marr has quit [Ping timeout: 246 seconds]
nism has joined #ruby
fgo has quit [Remote host closed the connection]
pierre1 has joined #ruby
samuel02 has joined #ruby
fantazo has joined #ruby
JasmeetQA has joined #ruby
sassamo has joined #ruby
JasmeetQA has quit [Read error: Connection reset by peer]
JasmeetQA has joined #ruby
samuel02 has quit [Ping timeout: 272 seconds]
nateberkopec has joined #ruby
JasmeetQA has quit [Client Quit]
JasmeetQA has joined #ruby
francisfish has joined #ruby
nism has quit [Ping timeout: 260 seconds]
sassamo has quit [Ping timeout: 265 seconds]
nateberkopec has quit [Ping timeout: 252 seconds]
okinomo has quit [Ping timeout: 260 seconds]
mlpinit has joined #ruby
eka has joined #ruby
alexfreidah has joined #ruby
mlpinit has quit [Ping timeout: 246 seconds]
gasbakid has joined #ruby
Deele has joined #ruby
VTLob has joined #ruby
fgo has joined #ruby
banister has joined #ruby
ndrei has quit [Quit: Lost terminal]
dangerousdave has joined #ruby
ndrei has joined #ruby
cbw has joined #ruby
sski has joined #ruby
alexfreidah has quit [Ping timeout: 252 seconds]
ktosiek has joined #ruby
arietis has joined #ruby
okinomo has joined #ruby
MrZYX|off is now known as MrZYX
nfk has joined #ruby
Lewix has quit [Remote host closed the connection]
davidk has joined #ruby
davidk is now known as Guest2068
yfeldblum has quit [Ping timeout: 252 seconds]
banjara has joined #ruby
abf has quit [Quit: Leaving]
mercwithamouth has joined #ruby
dukz has joined #ruby
dkamioka has joined #ruby
yaymukund has quit [Ping timeout: 260 seconds]
frog0909 has quit [Ping timeout: 272 seconds]
ahmedelgabri has quit [Remote host closed the connection]
jgrevich has quit [Quit: jgrevich]
banjara has quit [Ping timeout: 252 seconds]
dukz has quit [Remote host closed the connection]
dukz has joined #ruby
dkamioka has quit [Ping timeout: 252 seconds]
frog0909 has joined #ruby
ocline``` has joined #ruby
arietis has quit [Quit: Computer has gone to sleep.]
fgo has quit [Remote host closed the connection]
mehlah has joined #ruby
banister has quit [Quit: My MacBook has gone to sleep. ZZZzzz…]
Mon_Ouie has quit [Ping timeout: 272 seconds]
ocline`` has quit [Ping timeout: 260 seconds]
fgo has joined #ruby
dukz has quit [Ping timeout: 260 seconds]
justsee has quit [Ping timeout: 265 seconds]
dukz has joined #ruby
fgo has quit [Remote host closed the connection]
Zubin has joined #ruby
arietis has joined #ruby
Guest2068 has quit [Ping timeout: 265 seconds]
gja has joined #ruby
gja has quit [Changing host]
gja has joined #ruby
Zubin has quit [Quit: Leaving]
eka has quit [Quit: Computer has gone to sleep.]
Zubin has joined #ruby
<shevy> krainboltgreene I consider that a violation if the Rubinius guys don't include default stdlib
mansi has joined #ruby
nism has joined #ruby
RoryHughes has joined #ruby
carraroj has quit [Ping timeout: 252 seconds]
dukz has quit [Ping timeout: 272 seconds]
mansi has quit [Ping timeout: 260 seconds]
Czupa has joined #ruby
nateberkopec has joined #ruby
Zubin has quit [Ping timeout: 264 seconds]
RoryHughes has quit []
mercwithamouth has quit [Ping timeout: 272 seconds]
RoryHughes has joined #ruby
ahmedelgabri has joined #ruby
sassamo has joined #ruby
lkba has quit [Read error: Connection reset by peer]
arietis has quit [Quit: Computer has gone to sleep.]
nateberkopec has quit [Ping timeout: 272 seconds]
lkba has joined #ruby
sergicles has joined #ruby
aryaching has joined #ruby
LadyRainicorn has quit [Quit: Bye]
lkba has quit [Ping timeout: 265 seconds]
sassamo has quit [Ping timeout: 252 seconds]
arietis has joined #ruby
mlpinit has joined #ruby
gasbakid_ has joined #ruby
gasbakid has quit [Ping timeout: 272 seconds]
<shevy> warning: mismatched indentations at 'end' with 'unless' at 113
<shevy> this so reminds me of python :(
nism has quit [Remote host closed the connection]
ktosiek has quit [Remote host closed the connection]
<apeiros> shevy: why? ruby doesn't give that warning unless you tell it to
<shevy> I like other warnings but not this one
dukz has joined #ruby
gasbakid_ has quit [Read error: Connection reset by peer]
ry4nn has joined #ruby
mklappstuhl has joined #ruby
coderhs has joined #ruby
ryan__ has quit [Ping timeout: 276 seconds]
palachy has joined #ruby
freezey has joined #ruby
freezey has quit [Remote host closed the connection]
mlpinit has quit [Ping timeout: 272 seconds]
palachy has quit [Quit: WeeChat 0.4.0]
chihhsin has quit [Quit: leaving]
mojjojo has joined #ruby
DaZ has quit [Read error: Operation timed out]
sparrovv has quit [Read error: Connection reset by peer]
sparrovv has joined #ruby
mojjojo has quit [Client Quit]
tvw has joined #ruby
mojjojo has joined #ruby
chihhsin has joined #ruby
tvw has quit [Client Quit]
LekeFly has joined #ruby
camilasan has joined #ruby
assurbanipal has quit [Ping timeout: 252 seconds]
TMD has joined #ruby
yfeldblum has joined #ruby
shime has joined #ruby
intuxicated has quit [Ping timeout: 265 seconds]
TaxmanBD has quit [Ping timeout: 264 seconds]
mojjojo has quit [Quit: mojjojo]
pskosinski has quit [Quit: Til rivido Idisti!]
banjara has joined #ruby
dkamioka has joined #ruby
yfeldblum has quit [Ping timeout: 272 seconds]
<shevy> cool
<shevy> class Foo < some_method; end
<shevy> that works
assurbanipal has joined #ruby
dkamioka has quit [Ping timeout: 272 seconds]
<apeiros> shevy: yes, camping made that popular
banjara has quit [Ping timeout: 246 seconds]
<apeiros> class Foo < R('some_route')
lockweel has joined #ruby
<shevy> camping the framework? (for some reason I am thinking of camping as in base-defence at home bases in online games right now...)
<shevy> hmm
<shevy> R looks almost like a class
<apeiros> yupp. that got people confused. "How can it be that a class has an argument!?!?!"
<apeiros> of course it's just an uppercased method
<apeiros> like Kernel#Integer
kirun has joined #ruby
gja has quit [Quit: This computer has gone to sleep]
Jetchisel has left #ruby ["Unfortunately time is always against us -- *Morpheus*"]
agjacome has joined #ruby
sski has quit [Remote host closed the connection]
DaZ has joined #ruby
sski has joined #ruby
pierre1 has quit [Ping timeout: 272 seconds]
lyanchih has joined #ruby
DouweM has joined #ruby
<Hanmac1> class Foo < Baz::SomethingNotExistent would work too when Baz::const_missing respond to that ,P
Hanmac1 is now known as Hanmac
sski has quit [Ping timeout: 252 seconds]
chrisseaton has joined #ruby
fantazo_ has joined #ruby
nateberkopec has joined #ruby
phinfonet has joined #ruby
DouweM has quit [Ping timeout: 252 seconds]
fantazo_ has quit [Client Quit]
nateberkopec has quit [Ping timeout: 252 seconds]
<shevy> ruby projects have so strange names
<shevy> gem install sinatra
<shevy> gem install shotgun
DouweM has joined #ruby
colonolGron has quit [Ping timeout: 272 seconds]
Al1_andre has joined #ruby
dangerousdave has quit [Quit: My Mac Pro has gone to sleep. ZZZzzz…]
samuel02 has joined #ruby
LekeFly has quit [Quit: My MacBook Pro has gone to sleep. ZZZzzz…]
sassamo has joined #ruby
lockweel has quit [Ping timeout: 272 seconds]
okinomo has quit [Quit: Lost terminal]
ewnd9 has quit [Ping timeout: 260 seconds]
fixl has quit [Remote host closed the connection]
colonolGron has joined #ruby
<zxd> bundle exec unicorn
<zxd> bundler: command not found: unicorn
<zxd> Install missing gem executables with `bundle install`
<zxd> did that still can't find it
samuel02 has quit [Ping timeout: 260 seconds]
sassamo has quit [Ping timeout: 246 seconds]
sski has joined #ruby
JasmeetQA1 has joined #ruby
yasushi has joined #ruby
huttan has quit [Read error: Operation timed out]
mlpinit has joined #ruby
JasmeetQA has quit [Ping timeout: 264 seconds]
huttan has joined #ruby
pmlarocque has joined #ruby
<Hanmac> zxd #bundler has its own channel for its own problems ;P
<pmlarocque> #rubyonrails
<MrZYX> zxd: your Gemfile doesn't contain unicorn then
<zxd> MrZYX: it does
KJM has joined #ruby
<MrZYX> prove
<zxd> gem 'unicorn', '~> 4.0'
<MrZYX> run bundle which unicorn
<MrZYX> er, that was the gem version
MetaCosm has quit [Max SendQ exceeded]
MetaCosm has joined #ruby
KJM has left #ruby [#ruby]
<MrZYX> bundle show unicorn
grn has quit [Ping timeout: 245 seconds]
alexfreidah has joined #ruby
<zxd> bundle show unicorn
<zxd> .. /usr/local/rvm/gems/ruby-2.0.0-p247/gems/unicorn-4.6.3
caveat- has quit [Remote host closed the connection]
mlpinit has quit [Ping timeout: 272 seconds]
grn has joined #ruby
<zxd> bundle exec unicorn ; bundler: command not found: unicorn
caveat- has joined #ruby
<MrZYX> ls /usr/local/rvm/gems/ruby-2.0.0-p247/gems/unicorn-4.6.3/bin
<zxd> $ ls /usr/local/rvm/gems/ruby-2.0.0-p247/gems/unicorn-4.6.3/bin
<zxd> unicorn unicorn_rails
<MrZYX> bundle -v
<zxd> Bundler version 1.3.5
chrisseaton has quit []
<MrZYX> whatever, probably installing rvm as root went wrong yet another time
<shevy> hehe
<shevy> Hanmac likes bundler and rvm
<zxd> how to fix ?
<shevy> use better software
<MrZYX> not installing rvm as root is generally a good idea
alexfreidah has quit [Ping timeout: 252 seconds]
Svag has quit [Quit: changing servers]
Svag has joined #ruby
Svag has quit [Max SendQ exceeded]
Svag has joined #ruby
Svag has quit [Max SendQ exceeded]
<zxd> MrZYX: should unicorn binary installed under /usr/local/rvm/gems/ruby-2.0.0-p247/bin/ aswell?
<zxd> since rvm is installed as root?
Svag has joined #ruby
<zxd> it isn't there
<MrZYX> which -a unicorn
<MrZYX> unicorn: aliased to bundled_unicorn
<MrZYX> /home/mrzyx/.gem/ruby/2.0.0/bin/unicorn
<MrZYX> so probably
isieox has joined #ruby
Zhwazi has quit [Ping timeout: 252 seconds]
<zxd> why didn't it install it there automatically
<zxd> er
ixti has quit [Read error: Operation timed out]
Paradox has quit [Ping timeout: 245 seconds]
Svag has quit [Client Quit]
isieo has quit [Ping timeout: 248 seconds]
Svag has joined #ruby
Svag has quit [Max SendQ exceeded]
Svag has joined #ruby
Svag has quit [Max SendQ exceeded]
yfeldblum has joined #ruby
Svag has joined #ruby
Svag has quit [Max SendQ exceeded]
JasmeetQA has joined #ruby
Svag has joined #ruby
Paradox has joined #ruby
chrisramon has joined #ruby
JasmeetQA1 has quit [Ping timeout: 252 seconds]
aryaching has quit [Ping timeout: 272 seconds]
lockweel has joined #ruby
Xiti has quit [Ping timeout: 265 seconds]
dkamioka has joined #ruby
Svag has quit [Client Quit]
yfeldblum has quit [Ping timeout: 260 seconds]
Svag has joined #ruby
Svag has quit [Max SendQ exceeded]
Svag has joined #ruby
ixti has joined #ruby
bashdy has joined #ruby
JasmeetQA1 has joined #ruby
carraroj has joined #ruby
dukz has quit [Remote host closed the connection]
lockweel has quit [Ping timeout: 272 seconds]
Svag has quit [Client Quit]
JasmeetQA has quit [Ping timeout: 252 seconds]
Svag has joined #ruby
Svag has quit [Max SendQ exceeded]
dkamioka has quit [Ping timeout: 264 seconds]
Svag has joined #ruby
vlad_starkov has joined #ruby
<shevy> because it sucks!
vlad_starkov has quit [Remote host closed the connection]
aryaching has joined #ruby
vlad_starkov has joined #ruby
Svag has quit [Client Quit]
Svag has joined #ruby
Svag has quit [Max SendQ exceeded]
Svag has joined #ruby
Svag has quit [Max SendQ exceeded]
Svag has joined #ruby
ringaroses has joined #ruby
coderhs has quit [Ping timeout: 272 seconds]
vt102 has quit [Remote host closed the connection]
Lewix has joined #ruby
JaTochNietDan has quit [Ping timeout: 245 seconds]
Svag has quit [Client Quit]
Svag has joined #ruby
Svag has quit [Max SendQ exceeded]
nateberkopec has joined #ruby
Svag has joined #ruby
Svag has quit [Max SendQ exceeded]
Svag has joined #ruby
JaTochNietDan has joined #ruby
bubbajones has quit [Ping timeout: 272 seconds]
bubbajones has joined #ruby
mansi has joined #ruby
Svag has quit [Client Quit]
Svag has joined #ruby
Svag has quit [Max SendQ exceeded]
nateberkopec has quit [Ping timeout: 264 seconds]
Svag has joined #ruby
Svag has quit [Max SendQ exceeded]
Svag has joined #ruby
Svag has quit [Max SendQ exceeded]
Svag has joined #ruby
Svag has quit [Max SendQ exceeded]
Svag has joined #ruby
Svag has quit [Max SendQ exceeded]
mansi has quit [Ping timeout: 248 seconds]
Svag has joined #ruby
Svag has quit [Max SendQ exceeded]
Svag has joined #ruby
Svag has quit [Max SendQ exceeded]
nerium has joined #ruby
ewnd9 has joined #ruby
OdNairy has quit [Quit: My MacBook Pro has gone to sleep. ZZZzzz…]
Svag has joined #ruby
Svag has quit [Max SendQ exceeded]
Svag has joined #ruby
Svag has quit [Max SendQ exceeded]
mojjojo has joined #ruby
Svag has joined #ruby
Svag has quit [Max SendQ exceeded]
Svag has joined #ruby
Svag has quit [Max SendQ exceeded]
Svag has joined #ruby
Svag has quit [Max SendQ exceeded]
Svag has joined #ruby
Svag has quit [Max SendQ exceeded]
Svag has joined #ruby
Svag has quit [Max SendQ exceeded]
<DouweM> Could someone ban Svag? Thank you kindly.
Svag has joined #ruby
Svag has quit [Max SendQ exceeded]
yfeldblum has joined #ruby
Wolland has quit []
sassamo has joined #ruby
yfeldblum has quit [Ping timeout: 252 seconds]
bubbajones has quit [Ping timeout: 260 seconds]
samuel02 has joined #ruby
yaymukund has joined #ruby
sassamo has quit [Ping timeout: 252 seconds]
itadder has joined #ruby
<itadder> hi
<itadder> I am back
bashdy has quit [Quit: My MacBook Pro has gone to sleep. ZZZzzz…]
samuel02 has quit [Ping timeout: 248 seconds]
razibog has joined #ruby
mlpinit has joined #ruby
bubbajones has joined #ruby
bashdy has joined #ruby
browndawg has quit [Quit: Leaving.]
<apeiros> quick, everybody run! he's back!
coder_neo has quit [Ping timeout: 272 seconds]
ahmedelg_ has joined #ruby
huttan has quit [Remote host closed the connection]
alexfreidah has joined #ruby
pmlarocque has quit [Quit: pmlarocque]
mojjojo has quit [Quit: mojjojo]
mojjojo has joined #ruby
mlpinit has quit [Ping timeout: 272 seconds]
zigomir has joined #ruby
zigomir has quit [Remote host closed the connection]
coder_neo has joined #ruby
zigomir has joined #ruby
ahmedelgabri has quit [Ping timeout: 246 seconds]
noop has joined #ruby
<itadder> LOL
<itadder> apeiros:
<itadder> So far I understand the simple ruby stuff like \n variable = gets.chomp, puts = "something" and print
ahmedelg_ has quit [Ping timeout: 272 seconds]
krz has joined #ruby
spider-mario has quit [Read error: Connection reset by peer]
maroloccio has joined #ruby
ringaroses has quit [Quit: Leaving]
huttan has joined #ruby
huttan has quit [Remote host closed the connection]
heftig has quit [Ping timeout: 245 seconds]
wdiechmann has joined #ruby
<Morrolan> `puts = "something"`? Are you sure about that? :P
heftig has joined #ruby
Guest34004 has joined #ruby
huttan has joined #ruby
PaulePanter has quit [Quit: leaving]
PaulePanter has joined #ruby
dkamioka has joined #ruby
alexfreidah has quit [Ping timeout: 252 seconds]
rippa has joined #ruby
<itadder> no I am wrong
<itadder> puts "this is a statement"
jtdowney has quit [Read error: Connection reset by peer]
<itadder> this is a statement
<itadder> Morrolan: thanks for wacthing that
<itadder> catching
<Morrolan> :)
wdiechmann has quit [Quit: wdiechmann]
razibog has quit [Ping timeout: 260 seconds]
<itadder> awesome so far
shevy has quit [Ping timeout: 272 seconds]
huttan has quit [Read error: Operation timed out]
nerium has quit [Quit: nerium]
dkamioka has quit [Ping timeout: 260 seconds]
bashdy has quit [Quit: My MacBook Pro has gone to sleep. ZZZzzz…]
prc has joined #ruby
huttan has joined #ruby
vlad_sta_ has joined #ruby
Matriks has joined #ruby
nateberkopec has joined #ruby
pabloh has joined #ruby
vlad_starkov has quit [Ping timeout: 260 seconds]
nateberkopec has quit [Ping timeout: 272 seconds]
<MrZYX> itadder: puts adds a \n if there isn't already one, so you can save them there
shevy has joined #ruby
code010 has joined #ruby
RoryHughes has quit []
phansch has quit [Remote host closed the connection]
enebo has joined #ruby
phansch has joined #ruby
mansi has joined #ruby
eka has joined #ruby
lkba has joined #ruby
sepp2k has joined #ruby
mansi has quit [Ping timeout: 260 seconds]
razibog has joined #ruby
camilasan has quit [Ping timeout: 260 seconds]
baba has joined #ruby
yaymukund has quit [Ping timeout: 272 seconds]
SCommette has joined #ruby
aryaching_ has joined #ruby
tyl has joined #ruby
godd2 has quit [Ping timeout: 272 seconds]
yfeldblum has joined #ruby
aryaching has quit [Ping timeout: 260 seconds]
JasmeetQA has joined #ruby
JasmeetQA1 has quit [Ping timeout: 265 seconds]
bkparso has joined #ruby
yfeldblum has quit [Ping timeout: 248 seconds]
sassamo has joined #ruby
Matriks has quit [Remote host closed the connection]
mengu has joined #ruby
johnmilton has joined #ruby
browndawg has joined #ruby
Davey_ has joined #ruby
alexfreidah has joined #ruby
ewnd9 has quit [Remote host closed the connection]
ewnd9 has joined #ruby
mlpinit has joined #ruby
sassamo has quit [Ping timeout: 252 seconds]
samuel02 has joined #ruby
kristiandelay has joined #ruby
tyl has quit [Ping timeout: 252 seconds]
tyl has joined #ruby
poulson has joined #ruby
vt102 has joined #ruby
mlpinit has quit [Client Quit]
pu22l3r_ has joined #ruby
samuel02 has quit [Ping timeout: 248 seconds]
kristiandelay has quit [Ping timeout: 252 seconds]
cjsarette has quit [Ping timeout: 252 seconds]
stryek has joined #ruby
kate_r has joined #ruby
aboudreault has joined #ruby
prc has quit [Ping timeout: 264 seconds]
Davey_ has quit [Quit: Computer has gone to sleep.]
arietis has quit [Quit: Computer has gone to sleep.]
ahmedelgabri has joined #ruby
thealch3m1st has quit [Quit: Textual IRC Client: www.textualapp.com]
yasushi has quit [Remote host closed the connection]
IceDragon has joined #ruby
yasushi has joined #ruby
aryaching_ has quit [Ping timeout: 246 seconds]
arietis has joined #ruby
pu22l3r_ has quit [Remote host closed the connection]
aryaching has joined #ruby
dgfdgf has joined #ruby
bashdy has joined #ruby
thealch3m1st has joined #ruby
mhenrixon is now known as mhenrixon|afk
byprdct has joined #ruby
yasushi has quit [Ping timeout: 272 seconds]
`MArceLL` has quit [Ping timeout: 246 seconds]
aryaching has quit [Ping timeout: 260 seconds]
dkamioka has joined #ruby
code010 has quit [Ping timeout: 272 seconds]
yaymukund has joined #ruby
pskosinski has joined #ruby
bashdy has quit [Ping timeout: 260 seconds]
w4pm has joined #ruby
banjara has joined #ruby
nateberkopec has joined #ruby
mansi has joined #ruby
w4pm has quit [Read error: Operation timed out]
dkamioka has quit [Ping timeout: 264 seconds]
huttan has quit [Quit: leaving]
cjsarette has joined #ruby
rootshift has joined #ruby
mhenrixon|afk is now known as mhenrixon
pmlarocque has joined #ruby
hiall has quit [Quit: hiall]
hiall has joined #ruby
nateberkopec has quit [Ping timeout: 252 seconds]
ahmedelgabri has quit [Remote host closed the connection]
ahmedelgabri has joined #ruby
frog0909 has quit [Remote host closed the connection]
alexfreidah has quit [Ping timeout: 252 seconds]
mansi has quit [Remote host closed the connection]
mansi has joined #ruby
vlad_sta_ has quit [Remote host closed the connection]
ahmedelgabri has quit [Ping timeout: 252 seconds]
bashdy has joined #ruby
bashdy has quit [Remote host closed the connection]
bashdy has joined #ruby
mansi has quit [Ping timeout: 252 seconds]
danijoo has quit [Read error: Connection reset by peer]
danijoo has joined #ruby
vlad_starkov has joined #ruby
mary5030 has joined #ruby
larissa has joined #ruby
agjacome has quit [Ping timeout: 260 seconds]
aryaching has joined #ruby
Es0teric has joined #ruby
fantazo has quit [Ping timeout: 272 seconds]
nism has joined #ruby
ktosiek has joined #ruby
noob101 has joined #ruby
itadder has quit [Remote host closed the connection]
<noob101> Salutations.
<Morrolan> Heyho.
alexfreidah has joined #ruby
pmlarocque has quit [Quit: pmlarocque]
godd2 has joined #ruby
hiall_ has joined #ruby
Hanmac has quit [Read error: Connection reset by peer]
camilasan has joined #ruby
<nism> Namaskar!
hiall has quit [Ping timeout: 272 seconds]
hiall_ is now known as hiall
mansi has joined #ruby
mengu has quit [Remote host closed the connection]
mhenrixon is now known as mhenrixon|afk
mhenrixon|afk is now known as mhenrixon
sassamo has joined #ruby
mary5030 has quit [Remote host closed the connection]
Travis-42 has joined #ruby
<Travis-42> I have an array of hashes like, [{name: "John", weight: 8}, {name: "Bob", weight: 6}, {name: "John", weight: 4}]. I want to remove all the elements with similar names, but remove the one with the lower weight. What makes sense as a way to do this?
bkparso has quit [Quit: bkparso]
bkparso_ is now known as bkparso
banjara has quit [Ping timeout: 265 seconds]
<Morrolan> So if there's multiple 'persons' with the same name, you want to keep the one with the higher weight?
bashdy has quit [Quit: My MacBook Pro has gone to sleep. ZZZzzz…]
<canton7> #group_by similar names, then #map the one with the highest weight
nism-pi has joined #ruby
ahmedelgabri has joined #ruby
sassamo has quit [Ping timeout: 252 seconds]
sharkman has quit [Quit: Lost terminal]
Ziarkaen has joined #ruby
<Morrolan> I'd go for #group_by, then #max with a custom block.
<apeiros> I'd go with reject with a memo hash
peregrin_ has joined #ruby
prc has joined #ruby
<canton7> yup group_by, map, and max_by
<apeiros> or actually just each with a memo hash
<noob101> Ruby > Java?
<Morrolan> Certainly.
<apeiros> noob101: define >
<noob101> True
mojjojo has quit [Quit: mojjojo]
samuel02 has joined #ruby
<Morrolan> If you ask this in ##java you'll get a different answer, though. ;)
<canton7> depends whether you need a scripting langauge or a statically typed langauge
<noob101> > = Greater
<shevy> Ruby < Java
<noob101> :O
<shevy> you will need less lines of code in ruby
mojjojo has joined #ruby
<noob101> >:(
<shevy> noob101 well what were you comparing anyway!
<canton7> depends what you're doing, and whether java has a library for it :P
<apeiros> noob101: greater in what terms? lexically? sure.
<noob101> I don't know, functionality?
<apeiros> they're both touring complete…
<apeiros> you can do about everything in each of those
<canton7> really depends on the problem being solved
<canton7> why do you think so many languages exist?
sassamo has joined #ruby
<godd2> Ruby > Java; You will need more time to process code
<apeiros> I prefer ruby over java
<apeiros> but whether ruby > java really depends on what you want to compare, or how you weight the parts you compare.
<apeiros> Travis-42: show us your current implementation?
<godd2> but apeiros we want to compare things on a single simplified dimension!!!
<apeiros> godd2: ok, lexical comparison it is! and then ruby > java!
<apeiros> lets rejoyce!
samuel02 has quit [Ping timeout: 265 seconds]
<MrZYX> now why is bigger better? :P
<Morrolan> Would you rather have a big cake or a small cake? A big house or a small house? :P
<noob101> Can you make a virus with Ruby? I'm just curious.
<godd2> MrZYX Cuase it starts with the same letter
<apeiros> MrZYX: he didn't say anything about better!
<noob101> Small House = Less Work and Managing.
<ktosiek> you can make a virus with anything
<apeiros> he only said ">"
<canton7> it's be useless unless the target machine has a ruby interpreter on it...
<godd2> ruby <=> java
<MrZYX> Morrolan: a big cake will taste bad if I can't eat it fast enough, big house = much to clean ;P
<noob101> The comparison operator or the spaceship operator.
huttan has joined #ruby
<Morrolan> I have yet to see a cake big enough that I couldn't eat it in time. :P
<noob101> Letus fly on the spaceship.
<Morrolan> But you've got a point about the house!
<godd2> Im all for buzzwords, but I'm not 5 years old.
itadder has joined #ruby
yaymukund has quit [Ping timeout: 252 seconds]
<krz> anyone good with chef recipes? how do i symlink a file?
<itadder> puppet
<godd2> Starfox <=> Evil Andross
<godd2> pew pew
<itadder> joking I do not use either
<itadder> is this how you create objects in ruby person=struct.new(:first_name,:last_name,)
<ktosiek> Struct?
<apeiros> itadder: case matters. don't say 'struct' when you mean 'Struct'.
<itadder> oh kay
<apeiros> and the answer is yes and no. yes, this expression creates a new object. but no, most objects are created in a different way.
ahmedelgabri has quit [Ping timeout: 252 seconds]
ahmedelgabri has joined #ruby
<shevy> itadder you must use a constant as class name. a constant is one with first character uppercased
mojjojo has quit [Quit: mojjojo]
<shevy> so sTRUCT could not be a class
<shevy> but you may file a feature request for that
<apeiros> shevy: yes it could
<ktosiek> oh?
<apeiros> >> x = Array; x.new
<eval-in> apeiros => [] (https://eval.in/91784)
<shevy> did you use x = array
<godd2> itadder: one would make a Struct when you need a class, but something very simple with little or no other methods in it except the symbols you passed to it.
yaymukund has joined #ruby
<apeiros> sTRUCT is not a constant. it's a local variable or method. but it can very well evaluate to a class.
virt|away has quit []
<itadder> all I want to is to store person object
<itadder> his last name first name and task
<ktosiek> what's the difference? Are constants non-overwriteable?
<shevy> hmm true, you could do: sTRUCT = Struct
<ktosiek> or is it just a convention?
<Morrolan> ktosiek: The interpreter will warn you if you rebind a constant.
<apeiros> itadder: then Person = Struct.new(:first_name, :last_name, :task) is a fine way to create a Person class.
<apeiros> ktosiek: sadly constants are reassignable. but as Morrolan said already, ruby warns you if you do.
<itadder> Oh thanks Let me toy around with this, so far after one week with ruby I am in love
mojjojo has joined #ruby
<itadder> for the first time I like a lang, not sure why
<apeiros> ktosiek: the main difference is that constants are globally reachable and can be namespaced.
RoryHughes has joined #ruby
<apeiros> ok, generally globally reachable, you could create constants which are not. it'd be rather deliberate, though.
mojjojo has quit [Client Quit]
ahmedelg_ has joined #ruby
<shevy> itadder what languages did you use before ruby?
<godd2> apeiros: like this? class MyClass; private; def get_my_const; MyConst = 3; end; end
<apeiros> godd2: no. that's actually something ruby raises upon :)
<shevy> SyntaxError: (irb):3: dynamic constant assignment
<itadder> c++
<apeiros> can't assign to a constant in a method
<itadder> and powershell
albertgrala has joined #ruby
<itadder> I like powershell tooo, but for none windows I like ruby
<shevy> well I think you can via Object.const_set or?
<apeiros> godd2: more like: m = Module.new do self::X = 1 end
<apeiros> since m is not globally reachable, neither is m::X
<shevy> cool... I get funny warnings... warning: toplevel constant Foo referenced by Bar::Foo
dann_ has joined #ruby
nateberkopec has joined #ruby
ahmedelgabri has quit [Ping timeout: 252 seconds]
<itadder> so to collect the person last name first name and task I do collect new_collect = collect.get
<apeiros> shevy: because you access ::Foo via Bar::Foo. Bar::Foo does not exist. but since ::Foo is defined in Kernel, and Kernel is mixed into Bar, Bar::Foo will resolve to ::Foo
rootshift has quit [Quit: My MacBook has decided to go to sleep. Zzzz..]
v10energy has joined #ruby
zachrab has joined #ruby
lukec has joined #ruby
Spami has joined #ruby
dkamioka has joined #ruby
zachrab has quit [Client Quit]
<godd2> shevy: const_set makes the constant as globally available as the module you set it on: http://ruby-doc.org/core-1.9.3/Module.html#method-i-const_set
zigomir has quit [Remote host closed the connection]
colonolGron has quit [Ping timeout: 252 seconds]
mhenrixon is now known as mhenrixon|afk
zigomir has joined #ruby
petertretyakov has joined #ruby
figgleberry has joined #ruby
Spami__ has quit [Ping timeout: 252 seconds]
tyl has quit [Quit: Textual IRC Client: www.textualapp.com]
tkuchiki has quit [Remote host closed the connection]
* apeiros guesses Travis-42 died in the meantime…
nateberkopec has quit [Ping timeout: 252 seconds]
mengu has joined #ruby
tkuchiki has joined #ruby
<itadder> so how do I collect input
<apeiros> $stdin.gets
<apeiros> string = $stdin.gets
IceDragon has quit [Ping timeout: 272 seconds]
dkamioka has quit [Ping timeout: 252 seconds]
zigomir has quit [Ping timeout: 272 seconds]
<shevy> itadder did you understand that
assurbanipal has quit [Remote host closed the connection]
<itadder> nope
<itadder> standard input.gets
<itadder> what ever the string input is make it standard input
tkuchiki has quit [Ping timeout: 272 seconds]
Hanmac has joined #ruby
mengu has quit [Ping timeout: 260 seconds]
<shevy> itadder you did not even read what apeiros wrote :-)
IceDragon has joined #ruby
zachrab has joined #ruby
<itadder> $stdin.gets
<shevy> \o/
<shevy> if you are on linux, you could probably use Readline.readline() too
<shevy> advantage is you get arrow keys working in history support, and tab completion
<godd2> itadder: there is a global variable $stdin that is a reference to the standard input. if you cann the gets method on it, it will wait for the standard input to return a string
<shevy> like "cd d<PRESS_TAB>" completed to a directory
<godd2> call* not cann
browndawg has quit [Quit: Leaving.]
<itadder> oh if I am on steve jobs OS
<itadder> Mac
albertgrala has quit [Quit: Leaving]
<dann_> steve jobs os
<dann_> steve jobs phone
<dann_> steve jobs computer
<dann_> steve jobs software
<ktosiek> steve jobs tombstone1
<dann_> ouch
<godd2> steve jobs keyboard
<shevy> steve jobs necrophilia
<ktosiek> imagine, iTombstone, with interactive archive of everything Apple knew about you!
<shevy> :(
<shevy> Apple and Google should merge already
sassamo has quit [Remote host closed the connection]
<shevy> I want to use Gopple products
<dann_> gopple
<ktosiek> nah, they are funnier separate
<godd2> way better than the iStone which persecutes windows users
sassamo has joined #ruby
<dann_> steve jobs underwear
<dann_> wait
<shevy> ewww
<shevy> please
araujo has quit [Remote host closed the connection]
<dann_> hold on let me make a redbubble account real quick
<shevy> dann_ I don't like your line of thought here
<dann_> shevy: innovation is often controversial
<dann_> and innovation is definitely steve jobs underwear
<dann_> 100%
<shevy> I think he bought only cheap underwear
<godd2> was novation the name of his pants?
<dann_> i'm going to wear steve jobs' face on my crotch
<dann_> brb
camilasan has quit [Ping timeout: 248 seconds]
araujo has joined #ruby
araujo has quit [Read error: Connection reset by peer]
lioninawhat has joined #ruby
lyanchih has quit [Quit: lyanchih]
tannerburson has joined #ruby
Ziarkaen has quit [Remote host closed the connection]
RoryHughes has quit []
alexfreidah has quit [Ping timeout: 252 seconds]
davidk has joined #ruby
davidk is now known as Guest68802
alexfreidah has joined #ruby
<ktosiek> koans, monks, why's poignant guide... is being spiritual or crazy about Ruby a precondition to learning it? Or just a side effect?
<ktosiek> (oh, and the Shoes guide too...)
skyjumper has quit [Changing host]
skyjumper has joined #ruby
Guest34004 has quit [Ping timeout: 272 seconds]
chrisseaton has joined #ruby
<Morrolan> The shoe's guide was written by _why, IIRC.
TheMoonMaster has quit [Excess Flood]
<ktosiek> oh, ok :-D
serp` has joined #ruby
pu22l3r_ has joined #ruby
kobain has joined #ruby
starkhalo has joined #ruby
banjara has joined #ruby
Travis-42 has quit [Quit: Travis-42]
tyl has joined #ruby
RoryHughes has joined #ruby
TheMoonMaster has joined #ruby
<shevy> in the old days
<shevy> now javaians took over
<shevy> like the Borg in star trek
pu22l3r_ has quit [Remote host closed the connection]
pu22l3r_ has joined #ruby
RoryHughes has quit [Client Quit]
mengu has joined #ruby
mengu has quit [Changing host]
mengu has joined #ruby
RoryHughes has joined #ruby
banjara has quit [Ping timeout: 272 seconds]
carraroj has quit [Ping timeout: 265 seconds]
pu22l3r_ has quit [Ping timeout: 265 seconds]
<noob101> Oh ruby, oh ruby. We love you oh ruby!
jbomo has joined #ruby
vlad_starkov has quit [Remote host closed the connection]
samuel02 has joined #ruby
vlad_starkov has joined #ruby
tannerburson has quit [Quit: tannerburson]
Kricir has joined #ruby
baba has quit [Ping timeout: 272 seconds]
OdNairy has joined #ruby
serp` has quit [Quit: serp`]
yaymukund has quit [Ping timeout: 272 seconds]
Fire-Dragon-DoL has joined #ruby
zachrab has quit [Remote host closed the connection]
zachrab has joined #ruby
samuel02 has quit [Ping timeout: 252 seconds]
r0nin has joined #ruby
MindfulMonk has joined #ruby
lioninawhat has quit [Remote host closed the connection]
yaymukund has joined #ruby
serp` has joined #ruby
dann_ has quit [Quit: Page closed]
chrisseaton has quit []
cj3kim has joined #ruby
shime has quit [Read error: Connection reset by peer]
shime_ has joined #ruby
lioninawhat has joined #ruby
zachrab has quit [Ping timeout: 252 seconds]
atmosx has joined #ruby
<atmosx> hello
<godd2> hola atmosx
stevenrockarts has joined #ruby
nateberkopec has joined #ruby
pmarsceill has joined #ruby
kewubenduben has quit [Ping timeout: 246 seconds]
phansch_ has joined #ruby
phansch has quit [Read error: Connection reset by peer]
hiall has quit [Quit: hiall]
lioninawhat has quit [Ping timeout: 272 seconds]
pmarsceill has quit [Read error: Connection reset by peer]
pmarscei_ has joined #ruby
Hanmac has quit [Quit: Leaving.]
nateberkopec has quit [Ping timeout: 246 seconds]
bashdy has joined #ruby
Naoe-Kanno has joined #ruby
stevenrockarts has quit [Quit: stevenrockarts]
stevenrockarts has joined #ruby
phansch_ is now known as phansch
dkamioka has joined #ruby
Naoe_Kanno has joined #ruby
SHyx0rmZ has quit [Ping timeout: 272 seconds]
mklappst_ has joined #ruby
sski has quit [Remote host closed the connection]
visof has quit [Quit: Lost terminal]
nism has quit [Read error: No route to host]
sski has joined #ruby
Naoe-Kanno has quit [Ping timeout: 272 seconds]
mklappstuhl has quit [Ping timeout: 246 seconds]
RoryHughes has quit []
dkamioka has quit [Ping timeout: 252 seconds]
artgoeshere_ has joined #ruby
Al1_andre has quit [Remote host closed the connection]
Al1_andre has joined #ruby
EngierkO has joined #ruby
serp` has quit [Quit: serp`]
chrisseaton has joined #ruby
sski has quit [Ping timeout: 272 seconds]
mhenrixon|afk is now known as mhenrixon
kenichi_ has joined #ruby
alexfreidah has quit [Ping timeout: 245 seconds]
EngierkO has quit [Read error: Connection reset by peer]
EngierkO has joined #ruby
xiphias has quit [Ping timeout: 240 seconds]
artgoeshere has quit [Ping timeout: 240 seconds]
xiphias has joined #ruby
kenichi has quit [Ping timeout: 240 seconds]
xiphias has quit [Ping timeout: 240 seconds]
xiphias has joined #ruby
xiphias has quit [Changing host]
xiphias has joined #ruby
asattar has joined #ruby
asattar has quit [Client Quit]
<itadder> oh
MatthewsFace has joined #ruby
mspah__ has joined #ruby
RoryHughes has joined #ruby
yacks has quit [Quit: Leaving]
EngierkO_ has joined #ruby
krz has quit [Quit: WeeChat 0.4.2]
nism has joined #ruby
nisstyre has joined #ruby
EngierkO has quit [Ping timeout: 265 seconds]
chrisseaton has quit []
sassamo_ has joined #ruby
sassamo_ has quit [Read error: Connection reset by peer]
coderhs has joined #ruby
sassamo_ has joined #ruby
zachrab has joined #ruby
EngierkO_ has quit [Ping timeout: 248 seconds]
zachrab has quit [Remote host closed the connection]
zachrab has joined #ruby
EngierkO has joined #ruby
pushpak has joined #ruby
MatthewsFace has quit [Quit: This computer has gone to sleep]
mspah__ has quit [Quit: This computer has gone to sleep]
MatthewsFace has joined #ruby
mspah__ has joined #ruby
sassamo has quit [Ping timeout: 272 seconds]
EngierkO has quit [Read error: Connection reset by peer]
peregrin_ has quit []
shime_ has quit [Ping timeout: 272 seconds]
Hanmac has joined #ruby
EngierkO has joined #ruby
colonolGron has joined #ruby
peregrin_ has joined #ruby
chrisseaton has joined #ruby
<itadder> oh ruby oh ruby
zachrab has quit [Ping timeout: 248 seconds]
EngierkO has quit [Read error: Connection reset by peer]
mhenrixon is now known as mhenrixon|afk
EngierkO has joined #ruby
mhenrixon|afk has quit [Quit: My MacBook Pro has gone to sleep. ZZZzzz…]
peregrin_ has quit [Client Quit]
charlies_ has quit [Ping timeout: 252 seconds]
bashdy has quit [Read error: Connection reset by peer]
charliesome has joined #ruby
stevenrockarts has quit [Ping timeout: 252 seconds]
fijimunkii has joined #ruby
tulak has joined #ruby
chrisseaton has quit []
bashdy has joined #ruby
RoryHughes has quit []
aantix has joined #ruby
arietis has quit [Quit: Computer has gone to sleep.]
lioninawhat has joined #ruby
<tulak> Hello, I'm trying to implement template like mechanism. I have file 'my_partial.template' containing some ruby code, which I want to evaluate in some context, I'm using instnace_eval File.read(template.path) but the problem is, when there is some error in my_partial.template, the exception stack ends on instance_eval method, how can I aj load that file into context in the way, that will keep tracking errors inside of my_partial.template file ?
lukec has quit [Quit: lukec]
<Hanmac> tulak: is it Rails?
<tulak> yes, but I'm building custom library, I'm not usign ERB
<Hanmac> tulak: #rubyonrails
cj3kim has quit [Remote host closed the connection]
<apeiros> tulak: instance_eval takes a second argument, the filename
<tulak> I think itt's more ruby like problem
<apeiros> which is used in backtraces
yfeldblum has joined #ruby
pmlarocque has joined #ruby
peregrin_ has joined #ruby
<tulak> apeiros: thanks, my bad I didn't check the documentation, it's precisely what I wanted
<apeiros> tulak: indeed, at least you notice ;-p
chrisseaton has joined #ruby
<noob101> puts "Hello World" Awesome program ever!
sski has joined #ruby
arietis has joined #ruby
<noob101> Who remembers their first Hello World program?
<apeiros> mine wasn't a hello world
alexfreidah has joined #ruby
figgleberry has quit [Read error: Connection reset by peer]
Davey_ has joined #ruby
<DouweM> The first non-HTML/CSS code I actually wrote myself instead of copying off the internet was probably a PHP Hello World
figgleberry has joined #ruby
klaas has quit [Quit: ZNC - http://znc.sourceforge.net]
yfeldblum has quit [Ping timeout: 272 seconds]
<apeiros> I actually don't remember what the first thing I did was. it's over 25y ago after all.
sski has quit [Ping timeout: 272 seconds]
zxd has quit [Ping timeout: 252 seconds]
cgore has quit [Read error: Connection reset by peer]
serp` has joined #ruby
TMD has quit [Quit: Leaving]
alexfreidah has quit [Ping timeout: 264 seconds]
Quintasan has joined #ruby
Davey_ has quit [Quit: Computer has gone to sleep.]
maletor has joined #ruby
vlad_sta_ has joined #ruby
<shevy> noob101 not sure ... possibly in Javascript via alert()
dkamioka_ has joined #ruby
vlad_sta_ has quit [Remote host closed the connection]
<shevy> noob101 though we also did TurboPascal I believe in school. I only remember that we had to calculate circles, rectangulars etc... cant recall a hello world
vlad_sta_ has joined #ruby
<Quintasan> Hi, I'm trying to write a image downloader and I wanted to allow the user to set up a delay between checks for new images, currently I'm doing -> delay = Integer(ARGV.shift) rescue 60 <- how bad is that? Generally I want to see if the argument is there and if it can be meaningfully converted into Integer, if not then make it 60
samuel02 has joined #ruby
Fractional has joined #ruby
nateberkopec has joined #ruby
vlad_starkov has quit [Ping timeout: 260 seconds]
<snapcase> how come "gem env" gives me $HOME/.gem/ruby/1.9.1 as default GEM_HOME on a 2.0.0p353 installation?
<shevy> snapcase does it?
g0bl1n has joined #ruby
<shevy> I dont even have GEM_HOME hmm
g0bl1n has quit [Changing host]
g0bl1n has joined #ruby
<shevy> I have two entries in GEM PATHS though
bradhe has joined #ruby
mhenrixon has joined #ruby
<snapcase> it does on my system (arch), I actually get three entries in GEM PATHS
<snapcase> two local, 1.9.1 and 2.0.0 and a global 2.0.0
Barrin6 has joined #ruby
<shevy> wow
<shevy> two different system paths for the same version?
<snapcase> hm, something actually sets GEM_HOME to 1.9.1, not sure where that happens though..
lukec has joined #ruby
sparrovv has quit [Remote host closed the connection]
<shevy> my system path for ruby 2.1.0 is at $RUBY_PATH/lib/ruby/2.1.0/
nateberkopec has quit [Ping timeout: 246 seconds]
samuel02 has quit [Ping timeout: 272 seconds]
razibog has quit [Ping timeout: 246 seconds]
sparrovv has joined #ruby
deens has joined #ruby
carraroj has joined #ruby
<shevy> /Programs/Ruby/2.1.0/lib/ruby/gems/2.1.0
<shevy> and my user one is $HOME/.gem/ruby/2.1.0
<shevy> that is from a source compilation
noob101 has quit [Ping timeout: 272 seconds]
fijimunkii has quit [Ping timeout: 252 seconds]
arietis has quit [Quit: Computer has gone to sleep.]
fijimunkii has joined #ruby
dkamioka_ has quit [Remote host closed the connection]
pmlarocque has quit [Quit: pmlarocque]
ahawkins has joined #ruby
zzak has quit [Ping timeout: 245 seconds]
deens has quit [Ping timeout: 272 seconds]
sparrovv has quit [Ping timeout: 272 seconds]
ClientAlive has joined #ruby
zzak has joined #ruby
phansch has quit [Read error: Connection reset by peer]
<ClientAlive> When it comes to web app. Is it possible there is anything within the app that would be involved with configuring the url/uri that launches it?
<ClientAlive> *to a web app*
cashnguns has joined #ruby
jgrevich has joined #ruby
<pontiki> ClientAlive: perhaps you mean routes?
serp` has quit [Quit: serp`]
<ClientAlive> Not sure what I mean. I'm pretty new to all this
AmericanJetStory has joined #ruby
AmericanJetStory has quit [Client Quit]
<pontiki> something like: "/posts/17/comments/23" ?
phansch has joined #ruby
<pontiki> 23rd comment on the 17th post?
<ClientAlive> I have apache2, passenger, redmine and I've been just battling this thing to use a suburi "localhost/redmine"
mhenrixon is now known as mhenrixon|afk
CaptainJet has joined #ruby
deens has joined #ruby
Xeago has joined #ruby
mhenrixon|afk has quit [Quit: My MacBook Pro has gone to sleep. ZZZzzz…]
<pontiki> so you need to tell the server to run your app from http://localhost/redmine
pmarscei_ has quit []
<pontiki> i'm not familiar enough with apache2/passenger to know exactly where/how to do that
tannerburson has joined #ruby
Fire-Dragon-DoL has quit [Quit: Leaving.]
RoryHughes has joined #ruby
<ClientAlive> I"ve been able to get it to go to localhost/redmine and the app launches but is broken (displays incorrectly). But I don't recall what I did to get that nor know what was happening behind the scenes to eventually serce that up (the latter being my bigger conceren - as well as the borked app)
rickruby has joined #ruby
<Hanmac> shevy: look at this many commits :D https://github.com/Hanmac/rwx/commits
<pontiki> ClientAlive: do you mean it's not delivering your assets? stylesheets, javascript, etc
jgrevich has quit [Quit: jgrevich]
mklappst_ has quit [Remote host closed the connection]
<pontiki> ClientAlive: you should also probably be asking about this over in #rubyonrails
<ClientAlive> pontiki: I think so. Not familiar with the terminology you using but the formatting on the page is lost (links line up vertically on the left) and there is not graphic/banner that shows the app banner.
Hanmac1 has joined #ruby
MatthewsFace has quit [Quit: This computer has gone to sleep]
mspah__ has quit [Quit: This computer has gone to sleep]
platzhirsch has joined #ruby
bashdy has quit [Quit: My MacBook Pro has gone to sleep. ZZZzzz…]
<platzhirsch> Any idea how that will work out when I have RVM installed locally for my user and globally on a system?
<pontiki> if the terms i'm using are not familiar, i doubt i can be of any help :(
mklappstuhl has joined #ruby
<ClientAlive> I no longer have the configuration set up to launch when using localhost/redmine (and don't recall what I did to get that, but I couold probably get that back if I tried for a while)
p4tux has quit [Ping timeout: 252 seconds]
g0bl1n has quit [Ping timeout: 252 seconds]
alexfreidah has joined #ruby
<ClientAlive> I'm so newb. I'm just trying to use the application is all
lukec has quit [Quit: lukec]
Fractional has quit [Remote host closed the connection]
<pontiki> maybe you should seek help from the redmine community intead
Hanmac has quit [Ping timeout: 260 seconds]
<ClientAlive> well, and have some organization to it's path/url since I have several web apps on here
<ClientAlive> yeah
agjacome has joined #ruby
razibog has joined #ruby
mklappstuhl has quit [Remote host closed the connection]
p4tux has joined #ruby
EngierkO has quit [Quit: My MacBook Pro has gone to sleep. ZZZzzz…]
ckinni has quit [Quit: My MacBook Pro has gone to sleep. ZZZzzz…]
sec^nd has quit [Quit: WeeChat 0.4.2]
Kricir has quit [Remote host closed the connection]
figgleberry has quit [Read error: Connection reset by peer]
tt1187 has quit [Ping timeout: 252 seconds]
EngierkO has joined #ruby
mansi has quit [Ping timeout: 272 seconds]
EngierkO has quit [Read error: Connection reset by peer]
lethjakman has joined #ruby
deens has quit [Remote host closed the connection]
bradhe has quit [Remote host closed the connection]
RoryHughes has quit []
bradhe has joined #ruby
rickruby has quit [Remote host closed the connection]
dangerousdave has joined #ruby
cbetta_afk is now known as cbetta
nari has quit [Ping timeout: 252 seconds]
mercwithamouth has joined #ruby
bradhe has quit [Ping timeout: 252 seconds]
razibog has quit [Ping timeout: 260 seconds]
RoryHughes has joined #ruby
LekeFly has joined #ruby
cbetta is now known as cbetta_afk
monkegjinni has joined #ruby
sparrovv has joined #ruby
Neomex has joined #ruby
newUser1234 has joined #ruby
yaymukund has quit [Ping timeout: 260 seconds]
RoryHughes has quit [Client Quit]
miskander has joined #ruby
miskander has quit [Client Quit]
ph8 has quit [Ping timeout: 246 seconds]
deens has joined #ruby
estebistec has joined #ruby
JasmeetQA has quit [Quit: Leaving.]
Zhwazi has joined #ruby
nism has quit [Ping timeout: 252 seconds]
Hobogrammer has quit [Ping timeout: 272 seconds]
noop has quit [Ping timeout: 246 seconds]
nism-pi has quit [Ping timeout: 252 seconds]
Hobogrammer has joined #ruby
jbomo has quit [Ping timeout: 260 seconds]
rootshift has joined #ruby
fijimunkii has quit [Read error: Connection reset by peer]
RoryHughes has joined #ruby
jbomo has joined #ruby
RoryHughes has quit [Client Quit]
r0nin has quit [Remote host closed the connection]
dorei has joined #ruby
drumusician has quit [Read error: Connection reset by peer]
Ponyo has quit [Ping timeout: 260 seconds]
peregrin_ has quit []
drumusician has joined #ruby
klaas has joined #ruby
dangerousdave has quit [Quit: My Mac Pro has gone to sleep. ZZZzzz…]
RoryHughes has joined #ruby
noop has joined #ruby
yfeldblum has joined #ruby
nateberkopec has joined #ruby
monkegjinni has quit [Remote host closed the connection]
monkegjinni has joined #ruby
RoryHughes has quit [Client Quit]
Advocation has joined #ruby
Matriks has joined #ruby
rickruby has joined #ruby
monkegjinni has quit [Read error: No route to host]
nism has joined #ruby
monkegjinni has joined #ruby
newUser1234 has quit [Remote host closed the connection]
iamjarvo has joined #ruby
vlad_starkov has joined #ruby
newUser1234 has joined #ruby
mhenrixon has joined #ruby
nateberkopec has quit [Ping timeout: 248 seconds]
vlad_sta_ has quit [Ping timeout: 246 seconds]
samuel02 has joined #ruby
newUser1234 has quit [Ping timeout: 246 seconds]
eka has quit [Quit: Computer has gone to sleep.]
aantix has quit [Quit: aantix]
iamjarvo has quit [Ping timeout: 265 seconds]
MindfulMonk has quit [Quit: Leaving]
eka has joined #ruby
wedgeV has quit [Quit: wedgeV]
samuel02 has quit [Ping timeout: 252 seconds]
dorei has quit []
ckinni has joined #ruby
lidenbrock has joined #ruby
rootshift has quit [Quit: My MacBook has decided to go to sleep. Zzzz..]
camilasan has joined #ruby
starter2 has joined #ruby
<starter2> Hello, I got ruby from apt-get, ver 1.9.1, and have trouble installing ZentTest, gives error: Invalid gemspec in [/var/lib/gems/1.9.1/specifications/ZenTest-4.9.5.gemspec]: Illformed requirement ["< 3.0, >= 1.8"]
<starter2> I was wondering if 1.9.1 is still supported. I can try compiling a newer version, but that will require more time, sigh...
dorei has joined #ruby
OdNairy has quit [Quit: My MacBook Pro has gone to sleep. ZZZzzz…]
RoryHughes has joined #ruby
RoryHughes has quit [Client Quit]
Czupa has quit [Remote host closed the connection]
tannerburson has quit [Quit: tannerburson]
estebistec has quit [Remote host closed the connection]
danijoo has quit [Read error: Connection reset by peer]
danijoo has joined #ruby
starter2 has quit [Read error: Connection reset by peer]
enebo has quit [Quit: enebo]
ewnd9 has quit [Ping timeout: 272 seconds]
clamstar has joined #ruby
clamstar has quit [Client Quit]
w4pm has joined #ruby
arietis has joined #ruby
starter2 has joined #ruby
lioninawhat has quit [Remote host closed the connection]
lachesis has quit [Ping timeout: 276 seconds]
clamstar has joined #ruby
lioninawhat has joined #ruby
Advocation has quit [Quit: Advocation]
xybre has quit [Quit: bbiab]
<Morrolan> starter2: ZenTest claims to work on Ruby 1.8+, so I'd submit a ticket at its GitHub page.
w4pm has quit [Ping timeout: 264 seconds]
decoponio has quit [Quit: Leaving...]
<Morrolan> starter2: That being said - if you are a developer, I suggest you use Ruby 2.x, or at least 1.9.3
<starter2> I need a package that requires all this stuff from ruby. And I am actually trying to get RubyInline to work, that needs Zentest 4.3> so I tried installing ZenTest-4.3.1 and it worked.
Kricir has joined #ruby
vlad_starkov has quit [Remote host closed the connection]
MrZYX is now known as MrZYX|off
vlad_starkov has joined #ruby
yaymukund has joined #ruby
lioninawhat has quit [Ping timeout: 272 seconds]
mengu has quit [Ping timeout: 272 seconds]
ClientAlive has quit [Quit: I quit...]
MrZYX|off is now known as MrZYX
<starter2> Morrolan, that's what happens http://paste.ubuntu.com/6781862/
<starter2> il try posting a bug if you think this is bizzare
<starter2> maybe I am just screwing up
nism has quit [Ping timeout: 272 seconds]
<Morrolan> Wha... yes, this looks odd.
monkegjinni has quit [Read error: No route to host]
tyl has quit [Quit: My MacBook Pro has gone to sleep. ZZZzzz…]
<Morrolan> For some reason it seemingly attempts to install it twice. I'm not sure whether that's normal behaviour of Rubygems.
tulak has quit [Ping timeout: 246 seconds]
<Hanmac1> imo it looks like the hoe gem is fucked up ... starter2 did you have the newest version of the hoe gem?
<shevy> perhaps it duplicated some entries
monkegjinni has joined #ruby
r0nin has joined #ruby
<starter2> just ruby1.9.1-dev and ruby1.9.1
tulak has joined #ruby
<shevy> because it invokes it twice but normally gem uninstall runs only once
bradhe has joined #ruby
<Morrolan> https://github.com/seattlerb/zentest/ doesn't have any Gemspec in VCS, that doesn't make it easier trying to figure out what it does. :P
tannerburson has joined #ruby
carraroj has quit [Quit: Konversation terminated!]
<starter2> however, when i used -v 4.3.1 it worked like a charm, no odd errors
<shevy> good that Hanmac1 uses ubuntu :)
<Morrolan> Oh, he's using Hoe, eh.
<shevy> hehehe
Hanmac1 is now known as Hanmac
tyl has joined #ruby
<shevy> all those tools to build a sand castle... but the castle is still made out of sand!
<starter2> hoe gem isn't just an insult of gem right?... no idea what it is
<Morrolan> Never quite understood why people did that. The structure of the .gemspec was clear to me quite quickly. :)
xybre has joined #ruby
xybre has joined #ruby
xybre has quit [Changing host]
<Hanmac> shevy: i installed ZenTest on my machine and it did work without problems
<shevy> I am doing 'gem install ZenTest' right now
<shevy> I dont have ubuntu or hoe though
Liothen has quit [Quit: I Sleep!]
<Hanmac> hm i dont have hoe too and it did work ...
<shevy> Morrolan automatic changes with different versions was one reason
<shevy> Fetching: ZenTest-4.9.5.gem (100%)
<shevy> Successfully installed ZenTest-4.9.5
<shevy> 1 gem installed
<shevy> Installing ri documentation for ZenTest-4.9.5
<shevy> all installed fine!
<shevy> lemme uninstall!
<shevy> gem uninstall ZenTest
<shevy> Remove executables:
<shevy> autotest, multigem, multiruby, multiruby_setup, unit_diff, zentest
<shevy> huh
<shevy> ah yes
hiall has joined #ruby
<shevy> starter2 did not find ZenTest
Kricir has quit [Ping timeout: 272 seconds]
baroquebobcat has joined #ruby
<shevy> starter2 the .gem was still downloaded surely
<shevy> who is issuing the "Invalid gemspec" line?
mary5030 has joined #ruby
hiall has quit [Client Quit]
bradhe_ has joined #ruby
tt1187 has joined #ruby
spider-mario has joined #ruby
bradhe has quit [Ping timeout: 272 seconds]
tyl has quit [Client Quit]
pabloh has quit [Read error: Connection reset by peer]
<starter2> it did get downloaded
<starter2> because after i issued those lines, any other command i would issue, would give me the same error
<starter2> regarding the specifications file
<starter2> so what I would need to do, is delete that file, to avoid those errors
pabloh has joined #ruby
Notte has joined #ruby
prc has quit [Ping timeout: 272 seconds]
timonv has quit [Remote host closed the connection]
shime has joined #ruby
<starter2> and after issuing that install command, issuing an uninstall of zentest would show zentest is not installed
Xeago has quit [Remote host closed the connection]
<shevy> I never saw that error before, let's see
Lewix has quit [Remote host closed the connection]
Xeago has joined #ruby
<shevy> the gemspec seems to work though
<shevy> so I am unsure how it can be invalid
<shevy> someone else reported a similar one, also related to ZenTest http://stackoverflow.com/questions/18342345/zentest-4-9-3-shows-as-invalid-gemspec
<shevy> what was your gem version starter2 ?
<shevy> I have
<shevy> Ruby Version: ruby 1.9.3p484 (2013-11-22 revision 43786) [i686-linux]
<shevy> Rubygems Version: 2.1.11
<shevy> the post there claimed that "gem update --system" solved it
deens has quit [Remote host closed the connection]
pabloh has quit [Ping timeout: 248 seconds]
Lewix has joined #ruby
Lewix has quit [Remote host closed the connection]
deens has joined #ruby
Xeago has quit [Ping timeout: 252 seconds]
dorei has quit []
<starter2> shevy, sorry for the late reply, I have ruby1.9.1-dev and ruby1.9.1
<starter2> gem -v outputs: 1.8.23
MatthewsFace has joined #ruby
mspah_ has joined #ruby
<shevy> ok that is very old
<shevy> even ruby 1.8.7 had that eventually
<shevy> starter2 can you update to another gem version?
<starter2> i can try, any idea how?:)
<shevy> well
<shevy> you use debian/ubuntu so no idea
<shevy> but I can tell you how I do the upgrades
<shevy> I do it the silly way, gem itself allows you to update itself I think
rippa has quit [Quit: {#`%${%&`+'${`%&NO CARRIER]
<shevy> extract it, install it
<shevy> but!
<shevy> I am not sure that this will work for you
<MrZYX> that's indeed silly
<shevy> it works!
<Hanmac> "gem update --system" might work on ubuntu/debian too
<shevy> scary :D
<starter2> let em try
<shevy> but Hanmac uses ubuntu so you can try
<MrZYX> I thought they disabled that?
<shevy> hehe
<shevy> that would be funny
<shevy> Hanmac, are you sure you use ubuntu or is your system super-patched?
<starter2> the problem is that i already installed ZenTest 4.3.1 and a subsequent app is dependent on it, so I have to try not to uninstall it
<Hanmac> MrZYX: yes but there is a flag with you can enable it
<shevy> starter2 why not? all gems are downloaded locally and you can just re-install every local gem via "gem install bla.gem"
<Hanmac> shevy: my system ruby version is "ruby 2.0.0p299" but i still prefer nightly builds
nateberkopec has joined #ruby
pskosinski has quit [Ping timeout: 240 seconds]
nism has joined #ruby
razibog has joined #ruby
<starter2> ERROR: While executing gem ... (RuntimeError)
<starter2> gem update --system is disabled on Debian, because it will overwrite the content of the rubygems Debian package, and might break your Debian system in subtle ways. The Debian-supported way to update rubygems is through apt-get, using Debian official repositories.
<starter2> If you really know what you are doing, you can still update rubygems by setting the REALLY_GEM_UPDATE_SYSTEM environment variable, but please remember that this is completely unsupported by Debian.
<starter2> sorry for the long paste, i couldnt get it to upload to pastebinit
MatthewsFace has quit [Quit: This computer has gone to sleep]
mspah_ has quit [Quit: This computer has gone to sleep]
<starter2> this is for sudo gem update --system
dorei has joined #ruby
<starter2> apparently there is a way to install ZenTest with apt-get, not sure if that's a good diea
Liothen has joined #ruby
samuel02 has joined #ruby
danijoo has quit [Read error: Connection reset by peer]
ahawkins has quit [Quit: leaving]
<shevy> hehe
danijoo has joined #ruby
<shevy> they are like fightclub
<shevy> starter2, once you are in, there is no way to get out ;)
<starter2> yeah I was wondering about that:)
nateberkopec has quit [Ping timeout: 260 seconds]
razibog has quit [Quit: Leaving.]
pskosinski has joined #ruby
ephemerian has joined #ruby
<shevy> you could however ask the debian guys what "support" means
hiall has joined #ruby
<shevy> because it could be "we don't support those things or other versions, so bad luck"
<shevy> but there is hope!
<shevy> Hanmac somehow managed
<starter2> honestly, is there a more recent precompiled ruby for ubuntu, rather than 1.9.1?
clamstar has quit [Quit: Computer has gone to sleep.]
<starter2> Hanmac, did you install the most up to date ZenTest?
<shevy> Hanmac, from where do you have your ruby?
MatthewsFace has joined #ruby
<Hanmac> shevy: i compile ruby from trunk after a few days
mspah_ has joined #ruby
<shevy> k
<shevy> sorry starter2, he is a compiler like me :(
<starter2> ahhh, compiled....
<starter2> I am too, I just don't need ruby, and app does, so in these cases I do not compile:(
<Hanmac> hm ... current ruby is a week old ... *recompiling*
<starter2> compiling is soo much fun. anyone dare me to compile r-base?
_Andres has joined #ruby
<alexherbo2> how concat symbols?
mityaz has quit [Quit: See ya!]
<shevy> starter2 compiling is only fun if you have a solid structure to work with
<apeiros> alexherbo2: :"#{:a}#{b}"
<apeiros> alexherbo2: but symbols are NOT strings. if you concat symbols, you might be doing something where you should use strings.
<shevy> on default debian, compiling can be immensely frustrating
<alexherbo2> apeiros: http://bpaste.net/show/169866
mspah_ has quit [Client Quit]
MatthewsFace has quit [Client Quit]
Lewix has joined #ruby
<apeiros> alexherbo2: eh… metaprogramming-overkill
<apeiros> just use normal method definitions
<apeiros> nobody dies because of a line duplicated
<apeiros> pointless application of "DRY"
<alexherbo2> what is metaprogramming-overkill ?
<shevy> alexherbo2 you should use () for define_method really, the input to it should be a symbol, join your symbols by converting them into strings, then apply #to_sym on them
<apeiros> alexherbo2: that piece of code you pasted
<shevy> how you can work with one liners like that is amazing, I'd find that awful to work with mentally
<shevy> define_method method_name+:_sibling? do send(method_name+:_sibling) == self end
<shevy> I even doubt this is still ruby. This is more like PHPxxx 1.0 :\
proxie has joined #ruby
rickruby has quit [Remote host closed the connection]
rickruby has joined #ruby
<apeiros> alexherbo2: http://pastie.org/8648687
<RubyPanther> Yesterday I saw a kid I knew who was studying CS, he said he got a programming job... writing PHP. He ranks the worst things in history: PHP, cancer, hitler
<apeiros> you're obfuscating your code for no good reason IMO.
dangerousdave has joined #ruby
<Hanmac> it smells like someone trys to write another nokogiri ,P
ahmedelg_ has quit [Read error: Connection reset by peer]
rickruby has quit [Remote host closed the connection]
chrisramon has quit [Quit: chrisramon]
proxie has quit []
mspah_ has joined #ruby
mspah__ has joined #ruby
monkegji_ has joined #ruby
monkegjinni has quit [Read error: Connection reset by peer]
noop has quit [Read error: Connection reset by peer]
carif has quit [Ping timeout: 252 seconds]
sassamo_ has quit [Remote host closed the connection]
Matriks has quit [Remote host closed the connection]
klaas has quit [Quit: ZNC - http://znc.sourceforge.net]
aantix has joined #ruby
centrx has joined #ruby
sassamo has joined #ruby
pmlarocque has joined #ruby
nism has quit [Quit: Leaving]
assurbanipal has joined #ruby
baroquebobcat has quit [Quit: baroquebobcat]
mspah_ has quit [Quit: This computer has gone to sleep]
mspah__ has quit [Quit: This computer has gone to sleep]
serp` has joined #ruby
newUser1234 has joined #ruby
proxie has joined #ruby
tannerburson has quit [Ping timeout: 264 seconds]
sassamo has quit [Ping timeout: 246 seconds]
<shevy> RubyPanther perhaps he'll get rich
tannerburson has joined #ruby
sambao21 has joined #ruby
araujo has joined #ruby
aantix has quit [Quit: aantix]
justsee has joined #ruby
vlad_starkov has quit [Remote host closed the connection]
sambao21 has quit [Ping timeout: 265 seconds]
monkegjinni has joined #ruby
Quintasan has left #ruby [#ruby]
coderhs has quit [Ping timeout: 246 seconds]
rootshift has joined #ruby
bradhe_ has quit [Remote host closed the connection]
monkegji_ has quit [Ping timeout: 252 seconds]
dangerousdave has quit [Quit: My Mac Pro has gone to sleep. ZZZzzz…]
bradhe has joined #ruby
dkamioka has joined #ruby
klaas has joined #ruby
Neomex has quit [Quit: Neomex]
bradhe_ has joined #ruby
bradhe has quit [Read error: Connection reset by peer]
mesamoo has quit [Read error: Connection reset by peer]
Xaitec has joined #ruby
Kricir has joined #ruby
dh64 has joined #ruby
dh64 has quit [Read error: Connection reset by peer]
Neomex has joined #ruby
poulson has quit [Write error: Broken pipe]
canton7 has quit [Remote host closed the connection]
arietis has quit [Quit: Textual IRC Client: http://www.textualapp.com/]
canton7 has joined #ruby
cashnguns has quit [Quit: I'm just an old fashioned cowboy]
sassamo has joined #ruby
cbetta_afk is now known as cbetta
Kricir has quit [Ping timeout: 272 seconds]
rickruby has joined #ruby
Neomex has quit [Quit: Neomex]
yaymukund has quit [Ping timeout: 248 seconds]
aantix has joined #ruby
Neomex has joined #ruby
yshahin has joined #ruby
_chip_ has joined #ruby
MatthewsFace has joined #ruby
mspah_ has joined #ruby
Xaitec has quit [Remote host closed the connection]
dkamioka has quit [Remote host closed the connection]
rootshift has quit [Quit: My MacBook has decided to go to sleep. Zzzz..]
danijoo has quit [Read error: Connection reset by peer]
einarj has joined #ruby
baroquebobcat has joined #ruby
_chip_ has quit [Remote host closed the connection]
dkamioka has joined #ruby
danijoo has joined #ruby
Jetchisel has joined #ruby
pmlarocque has quit [Quit: pmlarocque]
lukec has joined #ruby
baroquebobcat has quit [Client Quit]
yfeldblum has quit [Read error: Connection reset by peer]
aantix has quit [Client Quit]
pmlarocque has joined #ruby
nateberkopec has joined #ruby
yaymukund has joined #ruby
horn has joined #ruby
prc has joined #ruby
horn has left #ruby [#ruby]
nisstyre has quit [Quit: Leaving]
MatthewsFace has quit [Quit: This computer has gone to sleep]
mspah_ has quit [Quit: This computer has gone to sleep]
hiall has quit [Quit: hiall]
nateberkopec has quit [Ping timeout: 252 seconds]
aantix has joined #ruby
lockweel has joined #ruby
Davedo has quit [Quit: Free as in Wine!]
lkba has quit [Ping timeout: 265 seconds]
dodosan has joined #ruby
aantix has quit [Client Quit]
chrisramon has joined #ruby
phansch has quit [Quit: Leaving]
habanany has joined #ruby
canton7 has quit [Remote host closed the connection]
canton7 has joined #ruby
maletor has quit [Quit: Computer has gone to sleep.]
dorei has quit []
itadder has quit []
seoNinjaWarrior has joined #ruby
sparrovv has quit [Remote host closed the connection]
petertretyakov has quit [Remote host closed the connection]
yoshie902a has joined #ruby
mhenrixon is now known as mhenrixon|afk
dorei has joined #ruby
kate_r has quit [Quit: My iMac has gone to sleep. ZZZzzz…]
Kricir has joined #ruby
lkba has joined #ruby
samuel02 has quit []
rootshift has joined #ruby
agent_white has joined #ruby
BraddPitt has quit [Quit: Leaving]
Kricir has quit [Ping timeout: 260 seconds]
Kricir_ has joined #ruby
Davedo has joined #ruby
wald0 has joined #ruby
serp` has quit [Quit: serp`]
sparrovv has joined #ruby
clamstar has joined #ruby
Kricir_ has quit [Ping timeout: 272 seconds]
starter2 has quit [Ping timeout: 265 seconds]
starter2 has joined #ruby
deens has quit [Remote host closed the connection]
timonv has joined #ruby
<shevy> dumdedum
lkba has quit [Ping timeout: 260 seconds]
coderhs has joined #ruby
nisstyre has joined #ruby
iamsean has quit [Quit: iamsean]
sambao21 has joined #ruby
iamsean has joined #ruby
timonv has quit [Ping timeout: 252 seconds]
yoshie902a has left #ruby [#ruby]
sambao21 has quit [Ping timeout: 264 seconds]
rootshift has quit [Quit: My MacBook has decided to go to sleep. Zzzz..]
<agent_white> I know that one!
SirCmpwn has quit [Quit: ZNC - http://znc.in]
chipotle has quit [Quit: cya]
aryaching has quit [Ping timeout: 264 seconds]
ckinni has quit [Read error: Connection reset by peer]
<shevy> :)
<shevy> agent_white, whatcha hacking on?
camilasan has quit [Ping timeout: 260 seconds]
nateberkopec has joined #ruby
ckinni has joined #ruby
<agent_white> shevy: My first ground-up Rails app! :) It's going alright I suppose, dreading adding styling to it. But I need to learn SASS :(
<agent_white> And yourself?
_Andres has quit [Read error: Connection reset by peer]
dapz has joined #ruby
rickruby has quit [Remote host closed the connection]
carif has joined #ruby
camilasan has joined #ruby
baroquebobcat has joined #ruby
nateberkopec has quit [Ping timeout: 272 seconds]
<shevy> hmm mostly just small things, maintaining small gems
<shevy> rewriting a few projects, which is awful and tedious ...
newUser1234 has quit [Quit: Leaving...]
<shevy> ruby is like the glue programming language
lkba has joined #ruby
lioninawhat has joined #ruby
<agent_white> shevy: Ouch... good to be busy than not though eh?
<agent_white> And it's like silly-putty
* agent_white mushes Ruby on his hands and giggles
<shevy> agent_white dunno... that's just programming alone. lots of other things todo in the coming week
ocline``` has quit [Ping timeout: 264 seconds]
<platzhirsch> amen
<platzhirsch> Lots of shitty things with missing passion for it :>
_Andres has joined #ruby
Jetchisel has left #ruby ["Unfortunately time is always against us -- *Morpheus*"]
<shevy> yeah
<platzhirsch> Straight way to burn out
<shevy> yeah
<shevy> now you have done it platzhirsch
<shevy> you depressed me :<
Notte has quit []
lidenbrock has quit [Ping timeout: 272 seconds]
BraddPitt has joined #ruby
<platzhirsch> I thought it feels good dragging someone else down, but turns out, it doesn't
<shevy> depends
<shevy> if you are a sadist, sure :)
yfeldblum has joined #ruby
vlad_starkov has joined #ruby
alexfreidah has quit [Ping timeout: 245 seconds]
clamstar has quit [Quit: Computer has gone to sleep.]
SirCmpwn has joined #ruby
marr has joined #ruby
<platzhirsch> Still have to finish my presentation, gosh, so much things to talk about. I am sick of it
vlad_starkov has quit [Read error: Connection reset by peer]
assurbanipal has quit [Ping timeout: 252 seconds]
<shevy> how long will the presentation be?
pskosinski has quit [Quit: Til rivido Idisti!]
<platzhirsch> 30min nothign really to complain about, but I have to slam a lot of things in
<platzhirsch> or else I am afraid my professors will think I am weak. lol
maletor has joined #ruby
Es0teric has quit [Quit: Computer has gone to sleep.]
thealch3m1st has quit [Quit: My MacBook Pro has gone to sleep. ZZZzzz…]
Es0teric has joined #ruby
<Hanmac> shevy 15 commits today ... and i add another sample (still not finish but growing)
rootshift has joined #ruby
max96at has quit [Quit: Textual IRC Client: www.textualapp.com]
<shevy> Hanmac \o/
rickruby has joined #ruby
<platzhirsch> 15 commits is nice
<Hanmac> platzhirsch: look at the last weeks https://github.com/Hanmac/rwx/graphs/commit-activity
<platzhirsch> don't know what happens when I see people push 60 commits on one day, that does not seem right
<platzhirsch> yeah, that looks proper :D
Neomex has quit [Ping timeout: 252 seconds]
<platzhirsch> getting things done
<Hanmac> platzhirsch: depends ... if i need to change something "little" but it need to be done in EACH file, i prefer one big commit ... otherwise i like to commit per file/class
camilasan has quit [Ping timeout: 264 seconds]
<platzhirsch> That's how it's supposed to be
zoscoy has joined #ruby
zoscoy has quit [Client Quit]
alexfreidah has joined #ruby
dkamioka has quit [Remote host closed the connection]
<Hanmac> platzhirsch: like a few weeks ago i changed the initialize methods to work with option hash (rb_scan_args with ":") ... that needed to be done in each of the files, and also restructure the entire init methods (because there was an addional way where the options also was needed) https://github.com/Hanmac/rwx/commit/1aa7290da010831bdf792ebe1da42aaaf4b9c90d << i commited it as "Massive Commit" ;P
<platzhirsch> Well, one logical unit :)
<Hanmac> ;P " 91 changed files with 1,906 additions and 632 deletions."
<platzhirsch> Was that done manually or using refactoring tools?
wald0 has quit [Quit: Lost terminal]
wald0 has joined #ruby
<Hanmac> everything with rwx is done manually
mercwithamouth has quit [Read error: Connection reset by peer]
olivier_bK has quit [Ping timeout: 252 seconds]
<shevy> I will become a loyal rwx user!
cashnguns has joined #ruby
<Hanmac> but tomorrow i will fix some errors in the corresponding wx sample first ;P
drumusician has quit [Read error: Connection reset by peer]
drumusician has joined #ruby
ndrei has quit [Read error: Operation timed out]
alexfreidah has quit [Ping timeout: 252 seconds]
<atmosx> I should have lolcommits installed today...
mhenrixon|afk is now known as mhenrixon
<atmosx> shevy: you use lolcommits?
AmLearning has joined #ruby
rootshift has quit [Quit: My MacBook has decided to go to sleep. Zzzz..]
blahness has joined #ruby
kenndel_ has quit [Ping timeout: 245 seconds]
MatthewsFace has joined #ruby
mspah_ has joined #ruby
blahness has quit [Client Quit]
phinfone_ has joined #ruby
peregrin_ has joined #ruby
phinfonet has quit [Ping timeout: 272 seconds]
peregrin_ has quit [Max SendQ exceeded]
<agent_white> shevy: I'm still jealous. I want to code for a living, it sounds awesome :)
peregrin_ has joined #ruby
ktosiek has quit [Read error: Operation timed out]
froy has quit [Ping timeout: 265 seconds]
ktosiek has joined #ruby
bean__ has joined #ruby
<bnagy> depends on what you're coding and for whom
<DouweM> what's stopping you?
baroquebobcat has quit [Quit: baroquebobcat]
ndrei has joined #ruby
<agent_white> DouweM: I'm still learning :) I'm wanting to get comfortable enough with Ruby and Rails to score an internship.
<DouweM> Ah :)
<agent_white> Since I'm on an extended break from university, at the moment ;P
baroquebobcat has joined #ruby
chrisramon has quit [Quit: chrisramon]
agjacome has quit [Ping timeout: 252 seconds]
<shevy> atmosx never hard of lolcommits
<shevy> agent_white I simply claimed that I know RoR
atraylen has joined #ruby
skulker has joined #ruby
baroquebobcat has quit [Client Quit]
starter2 has quit [Ping timeout: 252 seconds]
skulker has quit [Client Quit]
skulker has joined #ruby
<agent_white> shevy: I'll give that a whirl. "Well I like computers, sooo..."
<DouweM> It's a first step :P
mhenrixon is now known as mhenrixon|afk
<atmosx> shevy: here you go https://github.com/mroth/lolcommits
<shevy> agent_white hehe well, it sets you under pressure to get good at RoR
<mroth> hey, i wrote that!
mengu has joined #ruby
_Andres has quit [Ping timeout: 272 seconds]
<mroth> (first time seeing one of my projects mentioned in IRC, sorry excuse my excitement)
eka has quit [Quit: Computer has gone to sleep.]
<shevy> atmosx I constantly stare at my own code and wonder "wtf was I thinking ..."
<shevy> atmosx so my facial expression is constant "WTF!"
<atmosx> shevy: that's the nice thing about it :-P now we can laugh too!
<atmosx> haha
ldcicconi has joined #ruby
starter2 has joined #ruby
ldcicconi has left #ruby [#ruby]
mojjojo has joined #ruby
dkamioka has joined #ruby
lioninawhat has quit [Remote host closed the connection]
nateberkopec has joined #ruby
<agent_white> shevy: Very true! Though once I finish this app and have at least a little portfolio goin, I think I'll have a chance :)
sergicles has quit [Quit: sergicles]
einarj has quit [Remote host closed the connection]
ldcicconi has joined #ruby
bradhe_ has quit [Remote host closed the connection]
bradhe has joined #ruby
* apeiros wonders whether that link is safe…
bradhe has quit [Read error: Connection reset by peer]
MatthewsFace has quit [Quit: This computer has gone to sleep]
mspah_ has quit [Quit: This computer has gone to sleep]
bradhe has joined #ruby
mspah_ has joined #ruby
MatthewsFace has joined #ruby
<shevy> hehe
nateberkopec has quit [Ping timeout: 252 seconds]
<shevy> yeah
aryaching has joined #ruby
<shevy> it is safe but boring
<shevy> Hanmac had better links in the past
clamstar has joined #ruby
MatthewsFace has quit [Client Quit]
mspah_ has quit [Client Quit]
alexfreidah has joined #ruby
ldcicconi has quit [Ping timeout: 272 seconds]
aryaching has quit [Ping timeout: 248 seconds]
_Andres has joined #ruby
sparrovv has quit [Remote host closed the connection]
Xeago has joined #ruby
clamstar has quit [Ping timeout: 272 seconds]
AmLearning has quit [Read error: Connection reset by peer]
dodosan has quit [Remote host closed the connection]
alexfreidah has quit [Ping timeout: 272 seconds]
alexfreidah has joined #ruby
aryaching has joined #ruby
dodosan has joined #ruby
pskosinski has joined #ruby
mary5030 has quit [Read error: Connection reset by peer]
Xeago has quit [Ping timeout: 252 seconds]
mary5030 has joined #ruby
mary5030 has quit [Read error: Connection reset by peer]
mengu has quit []
mary5030 has joined #ruby
mary5030 has quit [Read error: Connection reset by peer]
MatthewsFace has joined #ruby
mspah_ has joined #ruby
mspah_ has quit [Remote host closed the connection]
MatthewsFace has quit [Remote host closed the connection]
MatthewsFace has joined #ruby
lockweel has quit [Ping timeout: 272 seconds]
mary5030 has joined #ruby
vlad_starkov has joined #ruby
dkamioka has quit [Remote host closed the connection]
deens has joined #ruby
phinfone_ has quit [Ping timeout: 252 seconds]
yoshie902a has joined #ruby
ldcicconi has joined #ruby
lidenbrock has joined #ruby
vlad_starkov has quit [Read error: Connection reset by peer]
aryaching has quit [Read error: Connection reset by peer]
chrisseaton has quit []
lukec has quit [Quit: lukec]
sparrovv has joined #ruby
baroquebobcat has joined #ruby
<yoshie902a> I'm getting a NameError: uninitialized constant Portfolio::Builder::Security error, http://pastie.org/8649119, any ideas how to reference Security directly without the Portfolio::Builder class?
chrisseaton has joined #ruby
lockweel has joined #ruby
mary5030 has quit [Read error: Connection reset by peer]
r0nin has quit [Read error: Connection reset by peer]
<waxjar> ::Security
r0nin has joined #ruby
r0nin has quit [Client Quit]
<Hanmac> yoshie902a: looks like an require problem ... portfolio/builder.rb need to require lib/security/security.rb
mary5030 has joined #ruby
wald0 has quit [Ping timeout: 252 seconds]
mcls has joined #ruby
<yoshie902a> Hanmac: you are right, thanks, I forgot it in my helper! thanks!
spider-mario has quit [Read error: Connection reset by peer]
mary5030 has quit [Read error: Connection reset by peer]
mary5030 has joined #ruby
claymore has quit [Quit: night]
ephemerian has quit [Ping timeout: 260 seconds]
pmlarocque has quit [Quit: pmlarocque]
skulker has quit []
fijimunkii has joined #ruby
skulker has joined #ruby
coder_neo has quit [Quit: Leaving]
mcls has quit [Client Quit]
colonolGron has quit [Quit: leaving]
baroquebobcat has quit [Quit: baroquebobcat]
Kricir has joined #ruby
skulker has quit [Client Quit]
funburn has joined #ruby
skulker has joined #ruby
LekeFly has quit [Quit: My MacBook Pro has gone to sleep. ZZZzzz…]
Kabaka has quit [Ping timeout: 260 seconds]
lockweel has quit [Ping timeout: 272 seconds]
iamjarvo has joined #ruby
Kricir has quit [Ping timeout: 272 seconds]
kotk1 has joined #ruby
MrZYX is now known as MrZYX|off
Kabaka has joined #ruby
baroquebobcat has joined #ruby
baroquebobcat has quit [Client Quit]
kotk has quit [Ping timeout: 246 seconds]
yoshie902a has quit [Quit: yoshie902a]
deens has quit [Remote host closed the connection]
MrZYX|off is now known as MrZYX
MatthewsFace has quit [Quit: This computer has gone to sleep]
mojjojo has quit [Quit: mojjojo]
mojjojo has joined #ruby
mary5030 has quit [Read error: Connection reset by peer]
SCommette has quit [Quit: SCommette]
mary5030 has joined #ruby
amclain has joined #ruby
Kricir has joined #ruby
synergy_ has joined #ruby
Lewix has quit [Remote host closed the connection]
hiall has joined #ruby
timonv has joined #ruby
deens has joined #ruby
mary5030 has quit [Read error: Connection reset by peer]
mary5030 has joined #ruby
aantix has joined #ruby
chipotle has joined #ruby
deens has quit [Remote host closed the connection]
AmLearning has joined #ruby
mary5030 has quit [Read error: Connection reset by peer]
lockweel has joined #ruby
mary5030 has joined #ruby
avidcoder010 has joined #ruby
iamsean has quit [Quit: iamsean]
<avidcoder010> I am here to learn about classes.
<avidcoder010> I have trouble understanding classes and how to produce instances of classes.
drumusician has quit [Ping timeout: 264 seconds]
<avidcoder010> Would anyone be willing to make an example of a classes for me on eval.in?
<Hanmac> object = klass.new
w4pm has joined #ruby
timonv has quit [Ping timeout: 272 seconds]
Jetchisel has joined #ruby
baroquebobcat has joined #ruby
AmLearning has quit [Remote host closed the connection]
<avidcoder010> Hanmac, what is that? I have no idea what that is.
<godd2> avidcoder010: check out http://docs.ruby-doc.com/docs/ProgrammingRuby/
<Hanmac> PS: some internal classes cant be crated with new like the children of Numeric for a reason ... but they have class-like methods for that ... like Integer() returns an integer
cashnguns has quit [Quit: I'm just an old fashioned cowboy]
styped has joined #ruby
<Hanmac> >> Integer("14")
<eval-in> Hanmac => 14 (https://eval.in/91849)
Al1_andre has quit [Quit: Ex-Chat Timed out]
<godd2> and click the link on the left labeled Classes, Objects, and Variables
mocfive has joined #ruby
<godd2> though I'd start with the Ruby.new link if this is your first go into Ruby
lockweel has quit [Ping timeout: 272 seconds]
funburn has quit [Quit: funburn]
iamsean has joined #ruby
iamsean has quit [Client Quit]
<centrx> >> puts "Hanmac, you have to start with the basics!"
<eval-in> centrx => Hanmac, you have to start with the basics! ... (https://eval.in/91850)
Beoran_ has joined #ruby
w4pm has quit [Ping timeout: 272 seconds]
mhenrixon|afk is now known as mhenrixon
nateberkopec has joined #ruby
AmLearning has joined #ruby
<avidcoder010> godd2, no thank you.
<soahccc> avidcoder010: Look it is even a stock example of eval.in => https://eval.in/147
<avidcoder010> I want someone to explain to me in full elaboration.
figgleberry has joined #ruby
ldcicconi has quit [Ping timeout: 272 seconds]
bradhe_ has joined #ruby
mhenrixon has quit [Quit: Textual IRC Client: www.textualapp.com]
<AmLearning> seems to be broadly used
<AmLearning> https: //www. youtube. com/watch? v=ezggtttr0kc
<AmLearning> , 00you, 04tube title: metallica - one (full lyrics) views: 11, 059, 448 likes: 46, 002 dislikes: 1, 013
carif has quit [Quit: Ex-Chat]
Beoran__ has quit [Ping timeout: 260 seconds]
<godd2> avidcoder010: you have a full elaboration available to you at http://docs.ruby-doc.com/docs/ProgrammingRuby/
<centrx> It looks like avidcoder010 is the same troll we had last night
<AmLearning> oh i'm sure
<AmLearning> , 00you, 04tube title: metallica - one (full lyrics) views: 233, 394 likes: 1, 013
<avidcoder010> soahccc, thank you for the class example. I appreciate it.
<AmLearning> you sound like someone who might not live very much
carif has joined #ruby
shime has quit [Ping timeout: 272 seconds]
bradhe has quit [Ping timeout: 248 seconds]
justsee has quit [Quit: leaving]
justsee has joined #ruby
<avidcoder010> soahccc, Can you do one more little thing for me please. The code looks great.
nateberkopec has quit [Ping timeout: 260 seconds]
<avidcoder010> Can you please put a comment next to each line explaining the significance and such if you want to, I would highly appreciate it. Thank you.
deens has joined #ruby
stevenrockarts has joined #ruby
mary5030 has quit [Read error: Connection reset by peer]
<avidcoder010> What is an instance variable.
mary5030 has joined #ruby
stevenrockarts has quit [Read error: Connection reset by peer]
MrZYX is now known as MrZYX|off
<godd2> avidcoder010: it's a variable created just for each instance of a class.
<godd2> so like, if you have a car class, each car has a different amount of gas in the tank, but you'd still want to reference the amount for that car by asking for the same variable
lockweel has joined #ruby
<avidcoder010> So every class that is made, it WILL DEFINITELY have an instance variable if instantiated right?
atmosx has quit [Quit: Lost in trance]
mojjojo has quit [Quit: mojjojo]
<godd2> In Ruby, the answer is technically no, but as far as you'd use the class for the most part, yes, an instance variable will act like it was always there
mehlah has quit [Quit: Leaving...]
alexfreidah has quit [Ping timeout: 245 seconds]
deens has quit [Ping timeout: 272 seconds]
mary5030 has quit [Read error: Connection reset by peer]
vlad_starkov has joined #ruby
mary5030 has joined #ruby
rubyracer has quit [Quit: Konversation terminated!]
bradhe_ has quit [Remote host closed the connection]
dapz has quit [Ping timeout: 246 seconds]
AmLearning has quit [Remote host closed the connection]
mojjojo has joined #ruby
bradhe has joined #ruby
TDJACR has joined #ruby
<avidcoder010> godd2, Would you please put a commend next to each line of code. I have no idea what I'm looking at. https://eval.in/147
<avidcoder010> comment*
skulker has quit [Remote host closed the connection]
mehlah has joined #ruby
<godd2> No offense, but no. I promise you'll get all the answers you're looking for if you jsut read the first two chapters of Programming Ruby: http://docs.ruby-doc.com/docs/ProgrammingRuby/html/intro.html
bradhe has quit [Read error: Connection reset by peer]
vlad_starkov has quit [Read error: Connection reset by peer]
<godd2> If you don't want to read the bounty of knowledge available to you in that book, that is your perogative, but I assure you it is worth the few hours of reading.
bradhe has joined #ruby
<avidcoder010> I rather not read the book but thank you very much for helping me.
<shevy> avidcoder010 commenting every line is too much work, if you have specific problems, ask, people will gladly help with that question
<shevy> it's such a small class that commenting it isn't really useful
<avidcoder010> Ok shevy.
<centrx> It is the same troll and/or retard
pskosinski has quit [Quit: Til rivido Idisti!]
<godd2> Good luck, another avenue (the way I got into ruby) is to watch the Ruby Essential Training series from Lynda.com
pskosinski has joined #ruby
<godd2> which I'm sure you can find in places other than Lynda.com...
<avidcoder010> What is this "@name" -> https://eval.in/147
Mapley is now known as DashieIsTheBest[
<shevy> avidcoder010 an instance variable
<shevy> avidcoder010 you use it to store data, pertaining to your given class
<avidcoder010> Instance variables store data according to strictly classes?
VTLob has quit [Quit: VTLob]
<shevy> avidcoder010 you use it to store data in your class ok
mojjojo has quit [Quit: mojjojo]
cbetta is now known as cbetta_afk
<shevy> you won't need any other use case as long as you are a newbie
<avidcoder010> shevy, are instance classes are only used for classes?
cbetta_afk is now known as cbetta
<shevy> what is an instance class
<avidcoder010> A variable used for classes right?
<shevy> I have no idea, you used that term, not me
<avidcoder010> Sigh. Thanks for the help.
mary5030 has quit [Read error: Connection reset by peer]
<godd2> avidcoder010 it looks like you're looking for a mentor. You could try http://www.railsmentors.org/ and I'm sure a mentor there can help you understand Ruby as well as Rails.
mary5030 has joined #ruby
<avidcoder010> I am looking for a mentor, how did you know? o_O?
<Hanmac> hm maybe he means a "singleton class" ...
<shevy> he needs to write code
<godd2> intuition
deens has joined #ruby
alexfreidah has joined #ruby
<avidcoder010> godd2 Should I make an account and do I get 1 on 1 chat with a mentor for free?
cbetta is now known as cbetta_afk
baroquebobcat has quit [Quit: baroquebobcat]
maletor has quit [Quit: Computer has gone to sleep.]
<godd2> I believe there is a link in the middle right there that reads "Sign up and get involved!"
chipotle has quit [Quit: cya]
mojjojo has joined #ruby
skulker has joined #ruby
freerobby has joined #ruby
skulker has quit [Remote host closed the connection]
<avidcoder010> godd2 thank you
pushpak has quit [Quit: Linkinus - http://linkinus.com]
zxd has joined #ruby
rootshift has joined #ruby
vlad_starkov has joined #ruby
bradhe has quit [Remote host closed the connection]
<davidcelis> What's up with rubygems right now? Getting a lot of Gem::RemoteFetcher::UnknownHostError
mary5030 has quit [Read error: Connection reset by peer]
bradhe has joined #ruby
mary5030 has joined #ruby
deens has quit [Ping timeout: 248 seconds]